Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU009991

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vcam1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGGCTCCAGACATTTACCCAGTTTACAGGCTGGAGATTGATCTGTTCAAGGGTGACCAGCTCATGAACAGACAGGAGTTTTCTTCAGAAGAGATGACAAAGTCTCTAGAAACCAAGAGTTTGGAAGTAACCTTTACTCCCGTCATTGAGGATATTGGAAAAGCTCTTGTTTGCCGAGCTAAATTACACATTGACCAAATTGATTCTACACTCAAAGAAAGGGAGACTGTCAAAGAACTACAAGTCTACATCTCTCCCAGGAATACAACGATCTCTGTACATCCCTCCACAAGGCTTCAAGAGGGTGGTGCTGTGACAATGACCTGTTCCAGCGAGGGTCTACCAGCTCCTGAGATTTTCTGGGGCAGGAAGTTAGATAATGAAGTTCTCCAGCTTCTCTCAGGAAATGCCATCCTC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Julie Belliere et al.
Theranostics, 5(11), 1187-1202 (2015-09-18)
Endothelial activation is a hallmark of cardiovascular diseases, acting either as a cause or a consequence of organ injury. To date, we lack suitable methods to measure endothelial activation in vivo. In the present study, we developed a magnetic resonance
Gareth W Fearnley et al.
Molecular biology of the cell, 25(16), 2509-2521 (2014-06-27)
Vascular endothelial growth factor A (VEGF-A) regulates many aspects of vascular physiology. VEGF-A stimulates signal transduction pathways that modulate endothelial outputs such as cell migration, proliferation, tubulogenesis, and cell-cell interactions. Multiple VEGF-A isoforms exist, but the biological significance of this

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico