Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU000411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sirt1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAAGCGGCTTGAGGGTAATCAATACCTGTTTGTACCACCAAATCGTTACATATTCCACGGTGCTGAGGTATACTCAGACTCTGAAGATGACGTCTTGTCCTCTAGTTCCTGTGGCAGTAACAGTGACAGTGGCACATGCCAGAGTCCAAGTTTAGAAGAACCCTTGGAAGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTGGAAGATGATACGGAGAGGCCCGAATGTGCTGGAGGATCTGGATTTGGAGCTGATGGAGGGGATCAAGAGGTTGTTAATGAAGCTATAGCTACAAGACAGGAATTGACAGATGTAAACTATCCATCAGACAAATCATAACACTATTGAAGCTGTCCGGATTCAGGAATTGCTCCACCAGCATTGGGAACTTTAGCA

Ensembl | mouse accession no.

ENSMUSG00000020063

NCBI accession no.

NP_062786

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SIRT1(93759) , Sirt1(93759)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hisae Yoshitomi et al.
PloS one, 12(8), e0183988-e0183988 (2017-09-01)
Diabetes is caused by the lack of release or action of insulin. Some foods and supplements can compensate for this deficiency; thus, they can aid in the prevention or treatment of diabetes. The aim of this study was to investigate
Xiwen Xiong et al.
PloS one, 14(2), e0212523-e0212523 (2019-02-23)
Nicotinamide phosphoribosyltransferase (NAMPT) is a rate-limiting enzyme in mammalian nicotinamide adenine dinucleotide (NAD)+ biosynthesis. Through its NAD+-biosynthetic activity, NAMPT influences the activity of NAD+-dependent enzymes, such as sirtuins. NAMPT is able to modulate processes involved in the pathogenesis of non-alcohol
Mickaël Ohanna et al.
Oncotarget, 5(8), 2085-2095 (2014-04-20)
SIRT1 operates as both a tumor suppressor and oncogenic factor depending on the cell context. Whether SIRT1 plays a role in melanoma biology remained poorly elucidated. Here, we demonstrate that SIRT1 is a critical regulator of melanoma cell proliferation. SIRT1
Yi Fu et al.
Cell metabolism, 32(6), 1052-1062 (2020-11-14)
Lipid accumulation in podocytes is a major determinant of diabetic kidney disease (DKD) and identification of potential therapeutic targets by mediating podocyte lipid metabolism has clinical importance. This study was to elucidate the role of JAML (junctional adhesion molecule-like protein)
Jie-Ning Zhu et al.
Scientific reports, 7(1), 11879-11879 (2017-09-21)
The molecular mechanisms underlying anthracyclines-induced cardiotoxicity have not been well elucidated. MiRNAs were revealed dysregulated in the myocardium and plasma of rats received Dox treatment. MicroRNA-34a-5p (miR-34a-5p) was verified increased in the myocardium and plasma of Dox-treated rats, but was
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico