EMNC000191
MISSION® esiRNA
targeting mouse Slc25a51
Seleccione un Tamaño
MXP 5,935.00
Fecha estimada de envío22 de abril de 2025
Seleccione un Tamaño
About This Item
MXP 5,935.00
Fecha estimada de envío22 de abril de 2025
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACAGCTGTTGCTTTGCATTTGCAGTGGTAAAATCCTGCTGTAACTAGCACTTGAACCCTGCCTGACCCTGGTTTTGTATGCTGACTCAGACCTGCTGACTAGTGGGAATTCACGTCTTTTAAGAATTACAGTCACCCTTTGCCCTGTTTTTGGTCAAAGACCTTTGTACTAAGGTCATATCTGGCTTTTGCATATCCCTGTGGGCTGAAAGTTACATTGAGTATTTAGAATTTACACTGTGCTTACATCACAGAAGTTTGACCCTTATTGGATCAAAGTGGATTTTGCTCCCTTGTGTTAGGTTCGGTGCCTTACAGC
GenBank accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SLC25A51(230125) , Mcart1(230125)
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Si necesita más asistencia, póngase en contacto con Atención al cliente
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Active Filters
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico