Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU230201

Sigma-Aldrich

MISSION® esiRNA

targeting human TAS2R14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGATGCAGCACACTGTCAAAATATCCGGAGACGCCAGCACCAAAGCCCACAGAGGAGTTAAAAGTGTGATCACTTTCTTCCTACTCTATGCCATTTTCTCTCTGTCTTTTTTCATATCAGTTTGGACCTCTGAAAGGTTGGAGGAAAATCTAATTATTCTTTCCCAGGTGATGGGAATGGCTTATCCTTCATGTCACTCATGTGTTCTGATTCTTGGAAACAAGAAGCTGAGACAGGCCTCTCTGTCAGTGCTACTGTGGCTGAGGTACATGTTCAAAGATGGGGAGCCCTCAGGTCACAAAGAATTTAGAGAATCA

Ensembl | nº de acceso humano

ENSG00000212127

Nº de acceso NCBI

NM_023922

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TAS2R14(106707243) , TAS2R14(50840)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ana C Duarte et al.
Biochemical pharmacology, 177, 113953-113953 (2020-04-10)
The regulation of transport mechanisms at brain barriers must be thoroughly understood, so that novel strategies for improving drug delivery to the brain can be designed. The blood-cerebrospinal fluid barrier (BCSFB) established by the choroid plexus (CP) epithelial cells has
Ana C Duarte et al.
Biochemical pharmacology, 177, 113954-113954 (2020-04-07)
The choroid plexus (CP) epithelial cells establish an important blood-brain interface, the blood-cerebrospinal fluid barrier (BCSFB), which constitutes a complementary gateway to the blood-brain-barrier for the entrance of several molecules into the central nervous system (CNS). However, the mechanisms that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico