Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU156661

Sigma-Aldrich

MISSION® esiRNA

targeting human NFE2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATGCTCCAAGTGAGCCATCATTTGAGCCCCAAGCCCCAGCTCCATACCTTGGACCTCCACCACCCACAACTTACTGCCCCTGCTCAATCCACCCAGATTCTGGCTTCCCACTTCCTCCACCACCTTATGAGCTCCCAGCATCCACATCCCATGTCCCAGATCCCCCATACTCCTATGGCAACATGGCCATACCAGTCTCCAAGCCACTGAGCCTCTCAGGCCTGCTCAGTGAGCCGCTCCAAGACCCCTTAGCCCTCCTGGACATTGGGCTGCCAGCAGGGCCACCTAAGCCCCAAGAAGACCCAGAATCCGACTCAGGATTATCCCTCAACTATAGCGATGCTGAATCTCTTGAGCTGGAGGGGACAGAGGCTGGTCGGCGGCGCAGCGAATATGTAGAGATGTACCCAGTGGAGTACCCCTACTCACTCATGCCCAACTCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shunying Jin et al.
Life sciences, 254, 117783-117783 (2020-05-16)
This study aimed to examine the anti-fibrotic role of Nuclear Factor-Erythroid derived 2 (NF-E2) in human renal tubule (HK-11) cells and in type 1 and type 2 diabetic (T1D, T2D) mouse kidneys. Anti-fibrotic effects of NF-E2 were examined in transforming
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Zhe Sha et al.
The Journal of cell biology, 217(5), 1757-1776 (2018-03-15)
Proteasome inhibitors are used as research tools and to treat multiple myeloma, and proteasome activity is diminished in several neurodegenerative diseases. We therefore studied how cells compensate for proteasome inhibition. In 4 h, proteasome inhibitor treatment caused dramatic and selective
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico