Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU155811

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACTCCAGCCTCCTCAACTGCGCCCCCCATAAGCTCCGGGCCCGGGGCGCTGGCCTCTGTGCCCGCCTCTCACCCGGCACACGGCTTGGCACCCCACGAGTCCCAGCTGCACCTGAAAGGGGACCCCCACTACTCCTTCAACCACCCGTTCTCCATCAACAACCTCATGTCCTCCTCGGAGCAGCAGCATAAGCTGGACTTCAAGGCATACGAACAGGCACTGCAATACTCGCCTTACGGCTCTACGTTGCCCGCCAGCCTGCCTCTAGGCAGCGCCTCGGTGACCACCAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCGGCGTACTACCAAGGTGTGTATTCCAGACCCGTCCTAAACACTTCCTAGCTCCCGGGACTGGGGGGTTTGTCTGGCATAGCCAT

Ensembl | nº de acceso humano

ENSG00000129514

Nº de acceso NCBI

NM_004496

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FOXA1(3169) , FOXA1(3169)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
UYU
HYU
ZXU
AHU
GQT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shixiong Wang et al.
International journal of molecular sciences, 19(12) (2018-12-24)
Forkhead box A1 (FOXA1) belongs to the forkhead class transcription factor family, playing pioneering function for hormone receptors in breast and prostate cancers, and mediating activation of linage specific enhancers. Interplay between FOXA1 and breast cancer specific signaling pathways has
Erina Anzai et al.
Biological & pharmaceutical bulletin, 40(9), 1483-1489 (2017-09-05)
Epithelial-to-mesenchymal transition (EMT) is an important process during embryonic development and tumor progression by which adherent epithelial cells acquire mesenchymal properties. Forkhead box protein A1 (FOXA1) is a transcriptional regulator preferentially expressed in epithelial breast cancer cells, and its expression
Shijun Lu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 69(7), 645-656 (2020-04-29)
Nowadays, sepsis-induced acute kidney injury (AKI) has gradually become a global problem for its high incidence and increasing mortality. Previous study has reported lncRNA ENST00000452391.1 in sepsis patients. However, its potential biological function and downstream molecular mechanism are still mysterious.
Suzie K Hight et al.
Neoplasia (New York, N.Y.), 22(8), 294-310 (2020-06-09)
Using a mini-library of 1062 lentiviral shRNAs targeting 40 nuclear hormone receptors and 70 of their co-regulators, we searched for potential therapeutic targets that would be important during in vivo tumor growth using a parallel in vitro and in vivo
Yeqing A Yang et al.
Nucleic acids research, 44(17), 8153-8164 (2016-06-04)
Forkhead box A1 (FOXA1) is an FKHD family protein that plays pioneering roles in lineage-specific enhancer activation and gene transcription. Through genome-wide location analyses, here we show that FOXA1 expression and occupancy are, in turn, required for the maintenance of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico