Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU151571

Sigma-Aldrich

MISSION® esiRNA

targeting human TWIST1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGGCGGAGCCCCCCACCCCCTCAGCAGGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAAAATATATGCCAAAGATTTTCTTGGAAATTAGAAGAGCAAAATCCAAATTCAAAGAAACAGGGCGTGGGGCGCACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGTGATTCCCAGACGGGCAGCGGCACCATCCTCACACCTCTGCATTCTG

Ensembl | human accession no.

ENSG00000122691

NCBI accession no.

NM_000474

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TWIST1(7291) , TWIST1(7291)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Li et al.
Oncology reports, 37(1), 185-192 (2016-11-24)
High expression of high mobility group protein A2 (HMGA2) is correlated with the invasiveness of gastric cancer and is an independent prognostic factor. The reason may be that HMGA2 promotes epithelial-mesenchymal transition (EMT) and the acquisition of tumor stem cell properties, yet
Mairéad A Cleary et al.
Stem cells and development, 26(10), 751-761 (2017-03-17)
Human bone marrow-derived mesenchymal stem cells (BMSCs) are clinically promising to repair damaged articular cartilage. This study investigated TWIST1, an important transcriptional regulator in mesenchymal lineages, in BMSC chondrogenesis. We hypothesized that downregulation of TWIST1 expression is required for in
Yutian Wang et al.
Frontiers in microbiology, 11, 1301-1301 (2020-07-01)
Staphylococcus aureus (S. aureus) infection-induced osteomyelitis is a great challenge in clinic treatment. Identification of the essential genes and biological processes that are specifically changed in mononuclear cells at an early stage of S. aureus osteomyelitis is of great clinical
Shi Chen et al.
Cancer letters, 383(1), 73-84 (2016-10-30)
The epithelial-mesenchymal transition (EMT) plays a crucial role in pancreatic ductal adenocarcinoma (PDAC) development and progression. TWIST activated by intra-tumoral hypoxia functions to promote the EMT. We hypothesized that TWIST and the downstream gene pathway could mediate PDAC progression under
Yuanbiao Zhang et al.
Molecular medicine reports, 23(5) (2021-03-25)
Long non‑coding RNAs are associated with cancer progression. Long intergenic non‑protein coding RNA (linc)‑regulator of reprogramming (ROR) enhances tumor development in hepatocellular carcinoma (HCC). However, the effect of chemoresistance and its underlying mechanisms in HCC are not completely understood. The
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico