Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU150021

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCGGTGATGAGCTACAGTGCCAAATTTGCTTCCTGTTTCTATGGCCCTTTCCGGGATGCAGCTAAGTCAAGCCCAGCTTTTGGGGACCGCCGCTGCTACCAGCTGCCCCCTGGAGCACGAGGCCTGGCTCTCCGAGCTGTGGACCGGGATGTACGGGAAGGAGCTGACATGCTCATGGTGAAGCCGGGAATGCCCTACCTGGACATCGTGCGGGAGGTAAAGGACAAGCACCCTGACCTCCCTCTCGCCGTGTACCACGTCTCTGGAGAGTTTGCCATGCTGTGGCATGGAGCCCAGGCCGGGGCATTTGATCTCAAGGCTGCCGTACTGGAGGCCATGACTGCCTTCCGCAGAGCAGGTGCTGACATCATCATCACCTACTACACACCGCAGCTGCTGCAGTGGCTGAAGGAGGAATGATGGA

Ensembl | nº de acceso humano

ENSG00000148218

Nº de acceso NCBI

NM_000031

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ALAD(210) , ALAD(210)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
SOT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhou Zheng et al.
Fish & shellfish immunology, 81, 168-175 (2018-07-17)
Shrimps, which mainly rely on their innate immune system to response to infectious pathogens, have clottable proteins as an important component of this system. While transglutaminases (TGase) are found in Litopenaeus vannamei and constitute part of the coagulation system, the
Guicai Gao et al.
Developmental and comparative immunology, 98, 99-107 (2019-05-06)
White spot syndrome, which is caused by white spot syndrome virus (WSSV), is a highly contagious disease of penaeid shrimp. However, there is currently incomplete understanding of the infection mechanism and pathogenesis of WSSV. In this study, a novel gene
Gang Liu et al.
Nature communications, 11(1), 6310-6310 (2020-12-11)
Heme biosynthesis and iron-sulfur cluster (ISC) biogenesis are two major mammalian metabolic pathways that require iron. It has long been known that these two pathways interconnect, but the previously described interactions do not fully explain why heme biosynthesis depends on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico