Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU146271

Sigma-Aldrich

MISSION® esiRNA

targeting human HNF1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACCTGCAGCAGCACAACATCCCACAGCGGGAGGTGGTCGATACCACTGGCCTCAACCAGTCCCACCTGTCCCAACACCTCAACAAGGGCACTCCCATGAAGACGCAGAAGCGGGCCGCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCGCAGCAGTTCACCCATGCAGGGCAGGGAGGGCTGATTGAAGAGCCCACAGGTGATGAGCTACCAACCAAGAAGGGGCGGAGGAACCGTTTCAAGTGGGGCCCAGCATCCCAGCAGATCCTGTTCCAGGCCTATGAGAGGCAGAAGAACCCTAGCAAGGAGGAGCGAGAGACGCTAGTGGAGGAGTGCAATAGGGCGGAATGCATCCAGAGAGGGGTGTCCCCATCACAGGCACAGGGGCTGGGCTCCAACCTCGTCACGGAGGTGCGTGTCTACAACTGGTTTGCCAACC

Ensembl | nº de acceso humano

ENSG00000135100

Nº de acceso NCBI

NM_000545

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HNF1A(6927) , HNF1A(6927)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Oğuzhan Fatih Baltacı et al.
Turkish journal of medical sciences, 48(3), 620-627 (2018-06-20)
Background/aim: MODY3 associated with HNF1A is the most common form of MODY and is clinically misdiagnosed as type 1 diabetes due to similar clinical symptoms. This study aimed to analyze the role of HNF1A-regulated miRNAs as a biomarker in the
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse
Ethan V Abel et al.
eLife, 7 (2018-08-04)
The biological properties of pancreatic cancer stem cells (PCSCs) remain incompletely defined and the central regulators are unknown. By bioinformatic analysis of a human PCSC-enriched gene signature, we identified the transcription factor HNF1A as a putative central regulator of PCSC
Shipra Shukla et al.
Cancer cell, 32(6), 792-806 (2017-11-21)
Prostate cancer exhibits a lineage-specific dependence on androgen signaling. Castration resistance involves reactivation of androgen signaling or activation of alternative lineage programs to bypass androgen requirement. We describe an aberrant gastrointestinal-lineage transcriptome expressed in ∼5% of primary prostate cancer that
Weigong Zhao et al.
International journal of molecular sciences, 16(5), 11699-11712 (2015-05-27)
MicroRNAs (miRNAs) have been reported to have diverse biological roles in regulating many biological processes, including osteogenic differentiation. In the present study, we identified that miR-24 was a critical regulator during osteogenic differentiation. We found that overexpression of miR-24 significantly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico