Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU142651

Sigma-Aldrich

MISSION® esiRNA

targeting human RSAD2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGAGCAATGGAAGCCTGATCCGGGAGAGGTGGTTCCAGAATTATGGTGAGTATTTGGACATTCTCGCTATCTCCTGTGACAGCTTTGACGAGGAAGTCAATGTCCTTATTGGCCGTGGCCAAGGAAAGAAGAACCATGTGGAAAACCTTCAAAAGCTGAGGAGGTGGTGTAGGGATTATAGAGTCGCTTTCAAGATAAATTCTGTCATTAATCGTTTCAACGTGGAAGAGGACATGACGGAACAGATCAAAGCACTAAACCCTGTCCGCTGGAAAGTGTTCCAGTGCCTCTTAATTGAGGGTGAGAATTGTGGAGAAGATGCTCTAAGAGAAGCAGAAAGATTTGTTATTGGTGATGAAGAATTTGAAAGATTCTTGGAGCGCCACAAAGAAGTGTCCTGCTTGGTGCCTGAATCTAACCAGAAGATGAAAGACTCCTACCTTATTCTGGATGAATATATGCGCTTTCTGAACTGTAGAAAGGGACGGAAGGA

Ensembl | human accession no.

ENSG00000134321

NCBI accession no.

NM_080657

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RSAD2(91543) , RSAD2(91543)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

B Wang et al.
Placenta, 36(6), 667-673 (2015-03-31)
Viperin, a virus-inducible antiviral protein, has been reported to inhibit the replication of a variety of viruses. However, its expression and function in trophoblast cells remains unclear. Toll-like receptor 3 (TLR3) is a key component of the innate immune system
Keaton M Crosse et al.
Immunology and cell biology, 99(4), 373-391 (2020-11-02)
Viperin is an interferon-inducible protein that is pivotal for eliciting an effective immune response against an array of diverse viral pathogens. Here we describe a mechanism of viperin's broad antiviral activity by demonstrating the protein's ability to synergistically enhance the
Ji-Su Jang et al.
Cell death & disease, 9(8), 823-823 (2018-08-03)
Dendritic cells (DCs) are the most potent professional antigen presenting cells and inducers of T cell-mediated immunity. However, few specific markers of mature DCs (mDC) have been reported. A previous microarray analysis revealed expression of mDC-specific genes and identified Rsad2
José R Peña Cárcamo et al.
Virology, 514, 216-229 (2017-12-05)
Junín arenavirus infections are associated with high levels of interferons in both severe and fatal cases. Upon Junín virus (JUNV) infection a cell signaling cascade initiates, that ultimately attempts to limit viral replication and prevent infection progression through the expression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico