Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU140031

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF18

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío02 de mayo de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío02 de mayo de 2025


descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGCACTTGCCTGTGTTTACACTTCCTGCTGCTGTGCTTCCAGGTACAGGTGCTGGTTGCCGAGGAGAACGTGGACTTCCGCATCCACGTGGAGAACCAGACGCGGGCTCGGGACGATGTGAGCCGTAAGCAGCTGCGGCTGTACCAGCTCTACAGCCGGACCAGTGGGAAACACATCCAGGTCCTGGGCCGCAGGATCAGTGCCCGCGGCGAGGATGGGGACAAGTATGCCCAGCTCCTAGTGGAGACAGACACCTTCGGTAGTCAAGTCCGGATCAAGGGCAAGGAGACGGAATTCTACCTGTGCATGAACCGCAAAGGCAAGCTCGTGGGGAAGCCCGATGGCACCAGCAAGGAGTGTGTGTTCATCGAGAAGGTTCTGGAGAACAACTACACGGCCCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jian Wu et al.
Cancer management and research, 12, 6767-6777 (2020-08-18)
The aim of this study was to evaluate whether estrogen promoted the proliferation and invasion of endometrial carcinoma (EC) cells through paracrine FGFs in endometrial stromal cells (ESCs). We screened gene alterations in a primary ESC culture after 10 nM
Jinglin Zhang et al.
Oncogene, 38(1), 33-46 (2018-08-08)
Fibroblast growth factors (FGFs) and their receptors are significant components during fundamental cellular processes. FGF18 plays a distinctive role in modulating the activity of both tumor cells and tumor microenvironment. This study aims to comprehensively investigate the expression and functional

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico