Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU136981

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAAGCAGCAGATCCAGAGGCAGATCCTCATCGCTGAGTTCCAGAGGCAGCACGAGCAGCTCTCCCGGCAGCACGAGGCGCAGCTCCACGAGCACATCAAGCAACAACAGGAGATGCTGGCCATGAAGCACCAGCAGGAGCTGCTGGAACACCAGCGGAAGCTGGAGAGGCACCGCCAGGAGCAGGAGCTGGAGAAGCAGCACCGGGAGCAGAAGCTGCAGCAGCTCAAGAACAAGGAGAAGGGCAAAGAGAGTGCCGTGGCCAGCACAGAAGTGAAGATGAAGTTACAAGAATTTGTCCTCAATAAAAAGAAGGCGCTGGCCCACCGGAATCTGAACCACTGCATTTCCAGCGACCCTCGCTACTGGTACGGGAAAACGCAGCACAGTTCCCTTGACCAGAGTTCTCCACCCCAGAGCGGAGTGTCGACCTCCTATAACCACCCGGTCCTGGGAATGTACGACGCCAAAGATGACTTCCCTCTTAGGAAAACAGCTTCTGAACCGAATCTGAAATTACGGTCCAGGC

Ensembl | human accession no.

ENSG00000068024

NCBI accession no.

NM_006037

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HDAC4(9759) , HDAC4(9759)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Todd J Cohen et al.
Molecules and cells, 38(4), 343-348 (2015-03-03)
Fiber type-specific programs controlled by the transcription factor MEF2 dictate muscle functionality. Here, we show that HDAC4, a potent MEF2 inhibitor, is predominantly localized to the nuclei in fast/glycolytic fibers in contrast to the sarcoplasm in slow/oxidative fibers. The cytoplasmic
Ling X Zhang et al.
American journal of physiology. Cell physiology, 307(4), C358-C372 (2014-06-20)
We have recently shown that in vivo inhibition of histone deacetylase (HDAC) stimulates endogenous myocardial regeneration in infarcted hearts (Zhang L et al. J Pharmacol Exp Ther 341: 285-293, 2012). Furthermore, our observation demonstrates that HDAC inhibition promotes cardiogenesis, which
GuoLiang Zou et al.
Biochimie, 165, 90-99 (2019-05-13)
The cardioprotection of catalpol and its mechanism in diabetic cardiomyopathy (DCM) remains unclear. Here, mouse cardiomyocytes were treated with high glucose (HG) to establish a model of cellular injury induced by HG. In vitro experiments were carried out and confirmed that
Y Yang et al.
Oncogene, 30(19), 2207-2218 (2011-01-19)
The transcriptional activity of the androgen receptor (AR) is regulated by both ligand binding and post-translational modifications, including acetylation and small ubiquitin-like modifier (SUMO)ylation. Histone deacetylases (HDACs) are known to catalyze the removal of acetyl groups from both histones and
Jung-Won Lee et al.
Nature communications, 10(1), 1897-1897 (2019-04-25)
The cellular decision regarding whether to undergo proliferation or death is made at the restriction (R)-point, which is disrupted in nearly all tumors. The identity of the molecular mechanisms that govern the R-point decision is one of the fundamental issues
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico