Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU135151

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCA2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCGAGGAAAAGCCAAACCTGTAGTGAGCGATTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGATGATGAGTGATCAGTATGGACCTTTTTCCTTGGTAGAACTGAATTCCTTCCTCCCCTGTCTCATTTCTACCCAGTGAGTTCATTTGTCATATAGGCACTGGGTTGTTTCTATATCATCATCGTCTATAAACTAGCTTTAGGATAGTGCCAGACAAACATATGATATCATGGTGTAAAAAACACACACATACACAAATATTTGTAACATATTGTGACCAAATGGGCCTCAAAGATTCAGATTGAAACAAACAAAAAGCTTTTGATGGAAAATATGTGGGTGGATAGTATATTTCTATGGGTGGGTCTAATTTGGTAACGGTTTGATTGTGCCTGGTTT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Erika Zernickel et al.
Molecular cancer therapeutics, 18(3), 656-666 (2018-11-28)
Targeting of epigenetic regulators as the chromatin remodeler SWI/SNF is proving to be a promising therapeutic strategy for individualized treatment of cancer patients. Here, we tested whether targeting one of the two mutually exclusive subdomains of the SWI/SNF complex BRM/SMARCA2
Tharu M Fernando et al.
Nature communications, 11(1), 5551-5551 (2020-11-05)
Genomic studies performed in cancer patients and tumor-derived cell lines have identified a high frequency of alterations in components of the mammalian switch/sucrose non-fermentable (mSWI/SNF or BAF) chromatin remodeling complex, including its core catalytic subunit, SMARCA4. Cells exhibiting loss of
Qiong Wu et al.
Journal of cellular physiology, 230(11), 2683-2694 (2015-03-27)
The Brahma (BRM) and Brahma-related Gene 1 (BRG1) ATPases are highly conserved homologs that catalyze the chromatin remodeling functions of the multi-subunit human SWI/SNF chromatin remodeling enzymes in a mutually exclusive manner. SWI/SNF enzyme subunits are mutated or missing in

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico