Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU132581

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGATGGGAAGAGAGAACTCACACAGATGGAAGAATCTTCTACATAAATCACAATATAAAAAGAACACAATGGGAAGATCCTCGGTTGGAGAATGTAGCAATAACTGGACCAGCAGTGCCCTACTCCAGGGATTACAAAAGAAAGTATGAGTTCTTCCGAAGAAAGTTGAAGAAGCAGAATGACATTCCAAACAAATTTGAAATGAAACTTCGCCGAGCAACTGTTCTTGAAGACTCTTACCGGAGAATTATGGGTGTCAAGAGAGCAGACTTCCTGAAGGCTCGACTGTGGATTGAGTTTGATGGTGAAAAGGGATTGGATTATGGAGGAGTTGCCAGAGAATGGTTCTTCCTGATCTCAAAGGAAATGTTTAACCCTTATTATGGGTTGTTTGAATATTCTGCTACGGACAATTATACCCTACAGATAAATCCAAACTCTGGATTGTGTAACGAAGATCACCTCTCTTACTTCAAGTTTATTGGTCGGGTAGC

Ensembl | human accession no.

ENSG00000069869

NCBI accession no.

NM_006154

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NEDD4(4734) , NEDD4(4734)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seon-Ae Jeon et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 14772-14783 (2019-11-07)
E3 ubiquitin ligases are involved in the regulation of oxidative stress-induced cell death. In this study, we investigated the role of neural precursor cell-expressed, developmentally down-regulated protein 4 (NEDD4) in regulation of hydrogen peroxide (H2O2)-induced cell proliferation and apoptosis in
Wu Wen et al.
Cell cycle (Georgetown, Tex.), 16(16), 1509-1514 (2017-07-27)
The neural precursor cell expressed developmentally downregulated protein 4 (NEDD4) plays a pivotal oncogenic role in various types of human cancers. However, the function of NEDD4 in bladder cancer has not been fully investigated. In the present study, we aim to
Shaoyan Feng et al.
Cell cycle (Georgetown, Tex.), 16(9), 869-878 (2017-04-06)
Nasopharyngeal carcinoma (NPC) is a highly invasive head-neck cancer derived from the nasopharyngeal epithelium, mainly prevalent in southern China and Southeast Asia. Radiotherapy and adjuvant cisplatin (DDP) chemotherapy are standard administrations applied in the treatment of NPC. However, resistance to
Qiong Lin et al.
Journal of cell science, 130(22), 3839-3850 (2017-10-13)
Our previous studies have shown that the HECT E3 ubiquitin ligase NEDD4 interacts with LC3 and is required for starvation and rapamycin-induced activation of autophagy. Here, we report that NEDD4 directly binds to SQSTM1 via its HECT domain and polyubiquitylates
Jin Zhang et al.
American journal of translational research, 11(6), 3461-3471 (2019-07-18)
Prostate cancer is the second most common malignancy among men and causes a myriad of health problem for males that are diagnosed with the cancer. Although the 5-year relative survival rate of prostate cancer patients has been significantly increased due
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico