Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU131511

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Fecha estimada de envío08 de abril de 2025

Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

MXP 5,935.00

Fecha estimada de envío08 de abril de 2025

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAATTCCAAAGGTGAAAACGCAGCCAACTGGCTCACGGCAAAGAGTGGTCGGAAGAAGCGCTGCCCCTACACGAAGCACCAGACACTGGAGCTGGAGAAGGAGTTTCTGTTCAATATGTACCTTACTCGAGAGCGGCGCCTAGAGATTAGCCGCAGCGTCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAACTGAAGAAAATGAATCGAGAAAACCGGATCCGGGAGCTCACAGCCAACTTTAATTTTTCCTGATGAATCTCCAGGCGACGCGGTTTTTTCACTTCCCGAGCGCTGGTCCCCTCCCTCTGTCTTCAGGCTCTGCCCAGGAACTCGCACCTGTGCTGGAGCCCTGTTCCTCCCTCCCACACTCGCCATCTCCTGGGCCGTTACATCTGTGCAGGGCTGGTTTGTTCTGACTTTTTGTTTCTTTGTGTTTGCTTGGTGC

Ensembl | human accession no.

ENSG00000153807

NCBI accession no.

NM_018951

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HOXA10(3206) , HOXA10(3206)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Wang et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(6), 839-846 (2018-12-14)
Endometrial receptivity is a critical factor for embryo implantation. A decrease in endometrial homeobox A10 (HOXA10) expression is associated with hypermethylation of its promoter and lower endometrial receptivity in animals and humans. 5-Aza-2'-deoxycytidine (AZA) is a DNA methyltransferase inhibitor. However
L Zhang et al.
Reproduction in domestic animals = Zuchthygiene, 52(6), 1081-1092 (2017-08-02)
Proper HOXA10 expression was essential for endometrial receptivity what was crucial for successful embryo implantation in mammalian. This study confirmed that miR-182 regulated the expression levels of HOXA10 by binding to its 3' UTR, selectively downregulated HOXA10 in goat endometrial
Xian-Ping Cui et al.
Digestive diseases and sciences, 59(7), 1442-1451 (2014-01-28)
HOXA10 is closely related to tumor progression in many human cancers. However, the role of HOXA10 in pancreatic cancer remains unclear. The aim of this study was to determine the involvement of HOXA10 in pancreatic cancer cell invasion and migration.
Zhi Long et al.
Endocrine-related cancer, 26(3), 279-292 (2019-01-23)
Homeobox A10 (HOXA10) is an important transcription factor that regulates the development of the prostate gland. However, it remains unknown whether it modulates prostate cancer (PCa) progression into castrate-resistant stages. In this study, we have applied RNA in situ hybridization

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico