Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU130891

Sigma-Aldrich

MISSION® esiRNA

targeting human TUG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TUG1(55000)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

E Zhang et al.
Cell death & disease, 7, e2109-e2109 (2016-02-26)
Recent evidence highlights long noncoding RNAs (lncRNAs) as crucial regulators of cancer biology that contribute to tumorigenesis. LncRNA TUG1 was initially detected in a genomic screen for genes upregulated in response to taurine treatment in developing mouse retinal cells. Our
Zhi-Qiang Li et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 46(10), 956-960 (2017-06-10)
This study sought to study the expression of the long non-coding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) in tongue squamous cell carcinoma (TSCC) and reveal its possible function. qRT-PCR was used to evaluate 27 samples of fresh TSCC tissues and
Jingjing Li et al.
Oncotarget, 8(39), 65932-65945 (2017-10-17)
Emerging evidence shows that the Hedgehog pathway and the long noncoding RNA TUG1 play pivotal roles in cell proliferation, migration, and invasion in tumors. However, the mechanism underlying the effect of TUG1 and the Hedgehog pathway in hepatoma remains undefined.
Heng Li et al.
Experimental and therapeutic medicine, 16(2), 779-787 (2018-08-18)
Taurine upregulated gene 1 (TUG1), a long non-coding RNA (lncRNA), has recently been suggested to be associated with the development of osteosarcoma (OS), but the underlying molecular mechanism still remains largely unclear. In the present study, it was revealed that
Huijuan Jiang et al.
Radiation oncology (London, England), 12(1), 65-65 (2017-04-06)
Long non-coding RNAs (lncRNAs) have been reported to regulate the sensitivity of different cancer cells to chemoradiotherapy. Aberrant expression of lncRNA Taurine-upregulated gene 1 (TUG1) has been found to be involved in the development of bladder cancer, however, its function

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico