Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU130711

Sigma-Aldrich

MISSION® esiRNA

targeting human FASN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Check Cart for Availability
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00

Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

Ensembl | nº de acceso humano

ENSG00000169710

Nº de acceso NCBI

NM_004104

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FASN(2194) , FASN(2194)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
MTU
QCS
FZS
WNS
FLS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xing Zhong et al.
Oncology letters, 21(4), 245-245 (2021-03-06)
Diffuse large B-cell lymphoma (DLBCL) is the most common and heterogeneous lymphoid malignancy. The subtype with MYC and BCL-2 double-expressor lymphoma (DEL) was defined by its aggressive nature and poor survival outcome. Therefore, the development of effective therapies for the
Xiaokun Gang et al.
The Prostate, 79(8), 864-871 (2019-04-08)
Fatty acid synthase (FASN) is vital for maintaining lipid homeostasis in prostate cancer (PCa) cells, which have an increased rate of de novo fatty acid (FA) synthesis. Mutations in the gene encoding the tumor suppressor speckle-type POZ protein (SPOP), which
Dan Cao et al.
Liver international : official journal of the International Association for the Study of the Liver, 37(1), 80-89 (2016-06-07)
Although it is well established that fatty acids (FA) are indispensable for the proliferation and survival of cancer cells in hepatocellular carcinoma (HCC), inhibition of Fatty Acid Synthase (FASN) cannot completely repress HCC cell growth in culture. Thus, we hypothesized
Gamze Ates et al.
Redox biology, 36, 101648-101648 (2020-08-31)
The oxidative degradation of lipids has been shown to be implicated in the progression of several neurodegenerative diseases and modulating lipid peroxidation may be efficacious for treating Alzheimer's disease (AD). This hypothesis is strengthened by recent findings suggesting that oxytosis/ferroptosis
Valeryia Mikalayeva et al.
International journal of molecular sciences, 20(6) (2019-03-21)
Both cytosolic fatty acid synthesis (FAS) and mitochondrial fatty acid oxidation (FAO) have been shown to play a role in the survival and proliferation of cancer cells. This study aimed to confirm experimentally whether FAS and FAO coexist in breast
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico