Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU127961

Sigma-Aldrich

MISSION® esiRNA

targeting human NCF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCAGCCAGCACTATGTGTACATGTTCCTGGTGAAATGGCAGGACCTGTCGGAGAAGGTGGTCTACCGGCGCTTCACCGAGATCTACGAGTTCCATAAAACCTTAAAAGAAATGTTCCCTATTGAGGCAGGGGCGATCAATCCAGAGAACAGGATCATCCCCCACCTCCCAGCTCCCAAGTGGTTTGACGGGCAGCGGGCCGCCGAGAACCGCCAGGGCACACTTACCGAGTACTGCGGCACGCTCATGAGCCTGCCCACCAAGATCTCCCGCTGTCCCCACCTCCTCGACTTCTTCAAGGTGCGCCCTGATGACCTCAAGCTCCCCACGGACAACCAGACAAAAAAGCCAGAGACATACTTGATGCCCAAAGATGGCAAGAGTACCGCGACAGACATCA

Ensembl | human accession no.

ENSG00000158517

NCBI accession no.

NM_000265

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NCF1(653361) , NCF1(653361)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hyo Jung Shin et al.
Polymers, 12(2) (2020-02-20)
Osteoarthritis (OA) is the most common joint disorder that has had an increasing prevalence due to the aging of the population. Recent studies have concluded that OA progression is related to oxidative stress and reactive oxygen species (ROS). ROS are
Dehong Yan et al.
The Journal of experimental medicine, 217(2) (2019-10-31)
Myeloid-derived suppressor cells (MDSCs) are "polarized" myeloid cells that effectively promote tumorigenesis by inhibiting antitumor immunity. How myeloid cells acquire the protumoral properties during tumorigenesis is poorly understood. We report here that the polarity protein TIPE2 (tumor necrosis factor-α-induced protein
Bharatwaj Sowrirajan et al.
Scientific reports, 7, 43441-43441 (2017-02-28)
Interleukin (IL)-27, a member of the IL-12 cytokine family, plays an important and diverse role in the function of the immune system. We have previously demonstrated that IL-27 is an anti-viral cytokine which inhibits HIV-1, HIV-2, Influenza virus and herpes
Tian Wang et al.
Biochemical and biophysical research communications, 489(4), 361-368 (2017-05-10)
In acute lung injury/acute respiratory distress syndrome (ALI/ARDS), pathogenesis is associated with the regulation of macrophage-generated oxidative stress, and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-derived reactive oxygen species(ROS) are key to regulating oxidative stress. In the present study, we
Matthew R DiStasi et al.
American journal of physiology. Heart and circulatory physiology, 306(10), H1435-H1443 (2014-03-19)
The role of NADPH oxidase (Nox) in both the promotion and impairment of compensatory collateral growth remains controversial because the specific Nox and reactive oxygen species involved are unclear. The aim of this study was to identify the primary Nox

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico