Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU126811

Sigma-Aldrich

MISSION® esiRNA

targeting human MRC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGTGGAAGAAGAAGCAGTCTTTCTTATGAAGATGCTGACTGTGTTGTTATTATTGGAGGTGCATCAAATGAAGCAGGAAAATGGATGGATGATACCTGCGACAGTAAACGAGGCTACATATGCCAGACACGATCCGACCCTTCCTTGACTAATCCTCCAGCAACGATTCAAACAGATGGCTTTGTTAAATATGGCAAAAGCAGCTATTCACTCATGAGACAAAAATTTCAATGGCATGAAGCGGAGACATACTGCAAGCTTCACAATTCCCTTATAGCCAGCATTCTGGATCCCTACAGTAATGCATTTGCGTGGCTGCAGATGGAAACATCTAATGAACGTGTGTGGATCGCCCTGAACAGTAACTTGACTGATAATCAATACACTTGGACTGATAAGTGGAGGGTGAGGTACACTAACTGGGCTGCTGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jinjian Huang et al.
Bioactive materials, 6(3), 770-782 (2020-10-08)
Herein, we report the synthesis of a biomimic hydrogel adhesive that addresses the poor healing of surgical anastomosis. Dopamine-conjugated xanthan gum (Da-g-Xan) is fabricated using deep insights into the molecular similarity between mussels' adhesive and dopamine as well as the
Gregor Olmes et al.
Arthritis research & therapy, 18, 90-90 (2015-01-01)
The role of macrophages in the pathogenesis of lupus nephritis, in particular their differentiation to a certain subtype (e.g., M1- or M2-like) modulating the inflammatory reaction, is unknown. Here we investigated whether the differentiation in M1- or M2-like macrophages depends
Tae-Wook Chung et al.
Oncotarget, 8(3), 4436-4448 (2016-12-30)
Tumor-derived gangliosides in the tumor microenvironment are involved in the malignant progression of cancer. However, the molecular mechanisms underlying the effects of gangliosides shed from tumors on macrophage phenotype remain unknown. Here, we showed that ganglioside GM1 highly induced the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico