Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU124361

Sigma-Aldrich

MISSION® esiRNA

targeting human UNC5B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTTGTTAGAGGGCCCAGAGTTCCTTCTCCACCCCCGCTCTCTCTCTCTTGGCCTGAGATCTCTGTGCAGGAACCAAGATGGGGCTGAAGCCTCTGGAGGCAGTTGGTTGGGGGCGGGCAGGCAGGAGGCCCTCCCTCCACCCCCCCACCCTCAGCCCGGCAACTTCTGGGTTCCATGGGTTTTAGTTCCGTTCTCGTTTTCTTCCTCCGTTATTGATTTCTCCTTTCTCCCTAAGCCCCCTTCTGCTTCCACGCCCTTTTCCTCTTTGAAGAGTCAAGTACAATTCAGACAAACTGCTTTCTCCTGTCCAAAAGCAAAAAGGCAAAGGAAAGAAAGAAAGCTTCAGACCGCTAGTAAGGCTCAAAGAAGAAGAAAAACACCAAAACCACAAGGGAAAAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zongyi Xie et al.
Brain, behavior, and immunity, 69, 190-202 (2017-11-23)
Neuroinflammation is an essential mechanism involved in the pathogenesis of subarachnoid hemorrhage (SAH)-induced brain injury. Recently, Netrin-1 (NTN-1) is well established to exert anti-inflammatory property in non-nervous system diseases through inhibiting infiltration of neutrophil. The present study was designed to
Junhui Chen et al.
Journal of cellular and molecular medicine, 23(3), 2256-2262 (2019-01-08)
Netrin-1 (NTN-1) is a novel drug to alleviate early brain injury following subarachnoid haemorrhage (SAH). However the molecular mechanism of NTN-1-mediated protection against early brain injury following SAH remains largely elusive. This study aims to evaluate the effects and mechanisms
Bo Wang et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(5), 939-954 (2019-01-16)
Normal bone mass is maintained by balanced bone formation and resorption. Myosin X (Myo10), an unconventional "myosin tail homology 4-band 4.1, ezrin, radixin, moesin" (MyTH4-FERM) domain containing myosin, is implicated in regulating osteoclast (OC) adhesion, podosome positioning, and differentiation in
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4
Dan Liu et al.
BMC ophthalmology, 14, 102-102 (2014-08-26)
Netrin-1 has been reported to promote retinal neovascularization in oxygen-induced retinopathy (OIR). However, netrin-1 receptors, which may mediate netrin-1 action during retinal neovascularization, have not been characterized. In this study, we investigated netrin-1 receptor subtype expression and associated changes in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico