Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU123791

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKDC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCGACTTGCGTGTGATGTTGATCAGGTGACAAGGCAACTGTATGAGCCACTAGTTATGCAGCTGATTCACTGGTTCACTAACAACAAGAAATTTGAAAGTCAGGATACTGTTGCCTTACTAGAAGCTATATTGGATGGAATTGTGGACCCTGTTGACAGTACTTTAAGAGATTTTTGTGGTCGGTGTATTCGAGAATTCCTTAAATGGTCCATTAAGCAAATAACACCACAGCAGCAGGAGAAGAGTCCAGTAAACACCAAATCGCTTTTCAAGCGACTTTATAGCCTTGCGCTTCACCCCAATGCTTTCAAGAGGCTGGGAGCATCACTTGCCTTTAATAATATCTACAGGGAATTCAGGGAAGAAGAGTCTCTGGTGGAACAGTTTGTGTTTGAAGCCTTGGTGATATACATGGAGAGTCTGGCCTTAGCACATGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xing-Mei Liang et al.
Acta pharmacologica Sinica, 42(4), 648-654 (2021-01-09)
The third-generation of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), represented by osimertinib, has achieved remarkable clinical outcomes in the treatment of non-small-cell lung cancer (NSCLC) with EGFR mutation. However, resistance eventually emerges in most patients and the underlying
Sonia Paget et al.
Oncotarget, 8(2), 2916-2935 (2016-12-10)
The tumor suppressor gene HIC1 (Hypermethylated In Cancer 1) encodes a transcriptional repressor mediating the p53-dependent apoptotic response to irreparable DNA double-strand breaks (DSBs) through direct transcriptional repression of SIRT1. HIC1 is also essential for DSB repair as silencing of
Lin Jia et al.
The Journal of pathology, 243(2), 255-266 (2017-08-05)
Endostatin was discovered as an endogenous angiogenesis inhibitor with broad-spectrum antitumour activities. Although clinical efficacy was observed when endostatin was combined with standard chemotherapy for non-small cell lung cancer (NSCLC), as well as other cancer types, the specific mechanisms underlying
Emanuela Dylgjeri et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5623-5637 (2019-07-04)
DNA-dependent protein kinase catalytic subunit (DNA-PK) is a pleiotropic kinase involved in DNA repair and transcriptional regulation. DNA-PK is deregulated in selected cancer types and is strongly associated with poor outcome. The underlying mechanisms by which DNA-PK promotes aggressive tumor
Sara Sofia Deville et al.
Cancers, 12(7) (2020-07-02)
The treatment resistance of cancer cells is a multifaceted process in which DNA repair emerged as a potential therapeutic target. DNA repair is predominantly conducted by nuclear events; yet, how extra-nuclear cues impact the DNA damage response is largely unknown.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico