Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU122971

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTACACGGAGGAACTGCTGCGGCACGTGGCCCCTGGGTTGCACCTGGAGCTTCGGGGGCCACAGCTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGGTGGGCGGACCCCCAGGCTCCGCCAGCCCCTCCACCCCAGCCTGCCTGCTGCCTCGGAACTGTGACACCCCCATCTTCGACTTCAGAGTCTTCTTCCAAGAGCTGGTGGAATTCCGGGCACGGCAGCGCCGTGGCTCCCCACGCTATACCATCTACCTGGGCTTCGGGCAGGACCTGTCAGCTGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAGCTGGAACCCTGGCTGTGCCGAGTGCACCTAGAGGGCACGCAGCGTGAGGGTGTGTCTTCCCTGGATAGCAGCAGCCTCAGCCTCTGCCTGTCCAGCGCCAACAGCCTCTATGACGACATCGAGTGCTTCCTTATGGAGC

Ensembl | human accession no.

ENSG00000185507

NCBI accession no.

NM_001572

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRF7(3665) , IRF7(3665)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rie Miyamoto et al.
Arthritis research & therapy, 12(3), R87-R87 (2010-05-18)
Plasmacytoid dendritic cells (pDCs) play not only a central role in the antiviral immune response in innate host defense, but also a pathogenic role in the development of the autoimmune process by their ability to produce robust amounts of type
Wenxin Wu et al.
Viruses, 12(4) (2020-04-03)
Influenza A virus (IAV) infection is a major cause of morbidity and mortality. Retinoic acid-inducible protein I (RIG-I) plays an important role in the recognition of IAV in most cell types, and leads to the activation of interferon (IFN). We
Kosuke Minaga et al.
Journal of gastroenterology, 55(5), 565-576 (2020-01-22)
Excessive type I IFN (IFN-I) production by plasmacytoid dendritic cells (pDCs) promotes autoimmunity. Recently, we reported that a prominent feature of both experimental autoimmune pancreatitis (AIP) and human type 1 AIP is pDC activation followed by enhanced production of IFN-I
N Ueno et al.
Oncogene, 36(31), 4481-4497 (2017-04-04)
We previously reported that PU.1 is downregulated in the majority of myeloma cell lines and primary myeloma cells of certain myeloma patients, and conditional expression of PU.1 in such myeloma cell lines induced cell cycle arrest and apoptosis. We found
Ying-Ying Xu et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(2), 576-592 (2018-07-22)
Although the interferon α (IFNα) signaling and the paired-like homeodomain transcription factor 2 (PITX2) have both been implicated in the progression of breast cancer (BCa), it remains obscure whether these two pathways act in a coordinated manner. We therefore aimed
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico