Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU121841

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGATCCAGGCCATGAAGAAGCTGCGGCACAAACACATCCTGGCGCTGTACGCCGTGGTGTCCGTGGGGGACCCCGTGTACATCATCACGGAGCTCATGGCCAAGGGCAGCCTGCTGGAGCTGCTCCGCGACTCTGATGAGAAAGTCCTGCCCGTTTCGGAGCTGCTGGACATCGCCTGGCAGGTGGCTGAGGGCATGTGTTACCTGGAGTCGCAGAATTACATCCACCGGGACCTGGCCGCCAGGAACATCCTCGTCGGGGAAAACACCCTCTGCAAAGTTGGGGACTTCGGGTTAGCCAGGCTTATCAAGGAGGACGTCTACCTCTCCCATGACCACAATATCCCCTACAAGTGGACGGCCCCTGAAGCGCTCTCCCGAGGCCATTACTCCACCAAATCCG

Ensembl | nº de acceso humano

ENSG00000101213

Nº de acceso NCBI

NM_005975

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PTK6(5753) , PTK6(5753)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
IYR
SXR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaohong Chen et al.
American journal of translational research, 8(10), 4354-4361 (2016-11-11)
Protein tyrosine kinase 6 (PTK6) is a nonreceptor tyrosine kinase that plays a crucial role in some tumors. However, the role of PTK6 is still unknown in hepatocellular carcinoma (HCC). In this study, we demonstrated that the PTK6 expression was
Tao Li et al.
Cancer management and research, 12, 6477-6491 (2020-08-18)
Serum response factor (SRF), a sequence-specific transcription factor, is closely related to metastasis of gastric cancer, a digestive tract cancer. Herein, we probed the effect of SRF on metastasis and progression of colon cancer (CC), another digestive tract disorder, and
Sayem Miah et al.
BMC cancer, 19(1), 78-78 (2019-01-18)
BRK is, a non-receptor tyrosine kinase, overexpressed in approximately 85% of human invasive ductal breast tumors. It is not clear whether BRK expression correlates with breast cancer subtypes, or the expression has prognostic or diagnostic significance. Herein, we investigated the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico