Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU116331

Sigma-Aldrich

MISSION® esiRNA

targeting human ENO1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATATGGGAAAGATGCCACCAATGTGGGGGATGAAGGCGGGTTTGCTCCCAACATCCTGGAGAATAAAGAAGGCCTGGAGCTGCTGAAGACTGCTATTGGGAAAGCTGGCTACACTGATAAGGTGGTCATCGGCATGGACGTAGCGGCCTCCGAGTTCTTCAGGTCTGGGAAGTATGACCTGGACTTCAAGTCTCCCGATGACCCCAGCAGGTACATCTCGCCTGACCAGCTGGCTGACCTGTACAAGTCCTTCATCAAGGACTACCCAGTGGTGTCTATCGAAGATCCCTTTGACCAGGATGACTGGGGAGCTTGGCAGAAGTTCACAGCCAGTGCAGGAATCCAGGTAGTGGGGGATGATCTCACAGTGACCAACCCAAAGAGGATCGCCAAGGCCGTGAACGAGAAGTCCTGCAACTGCCT

Ensembl | nº de acceso humano

ENSG00000074800

Nº de acceso NCBI

NM_001428

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ENO1(2023) , ENO1(128178)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
BBV
YWT
XDT
LBT
WNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoling Qian et al.
Oncotarget, 8(29), 47691-47708 (2017-05-27)
Chemotherapy is the major choice for the cancer treatment of early and advanced stages. However, intrinsic or acquired drug resistance significantly restricts the clinical efficacy of chemotherapy. It is critical to develop novel approaches to detect and overcome drug resistance.
Hui Qiao et al.
Journal of cellular biochemistry, 120(11), 18714-18723 (2019-06-21)
Gastric cancer has become the third most common cancer around the world. In patients with gastric cancer, the 5-year survival rate is still low. However, the mechanism underlying gastric cancer remains largely unknown. As a glycolytic enzyme, enolase 1 (ENO1)
Naoki Kishimoto et al.
Retrovirology, 17(1), 31-31 (2020-09-13)
A protein exhibiting more than one biochemical function is termed a moonlighting protein. Glycolytic enzymes are typical moonlighting proteins, and these enzymes control the infection of various viruses. Previously, we reported that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and alpha-enolase (ENO1) are
Yasmarie Santana-Rivera et al.
American journal of translational research, 12(4), 1275-1292 (2020-05-02)
Despite good responses to first-line treatment with platinum-based combination chemotherapy, most ovarian cancer patients will relapse and eventually develop a platinum-resistant disease with a poor overall prognosis. The molecular events leading to the cisplatin resistance of ovarian cancer cells are

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico