Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU109741

Sigma-Aldrich

MISSION® esiRNA

targeting human WDR5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTGAAGACGTACACTGGCCACAAGAATGAGAAATACTGCATATTTGCCAATTTCTCTGTTACTGGTGGGAAGTGGATTGTGTCTGGCTCAGAGGATAACCTTGTTTACATCTGGAACCTTCAGACGAAAGAGATTGTACAGAAACTACAAGGCCACACAGATGTCGTGATCTCAACAGCTTGTCACCCAACAGAAAACATCATCGCCTCTGCTGCGCTAGAAAATGACAAAACAATTAAACTGTGGAAGAGTGACTGCTAAGTCCCTTTGCTCCTGCCCGCGAGAGACTGTCGGGAAGTTGACCCGGATTGGCAAGAAACAGGGTGTCTTGGAGGTGGTCCCCCAGATCTGCGCCTGGGGGTCAGGACAGGGCCTGATTTGAGCCTCCTCTCTGAAGATGATTTGGCCGAGCGGAAGGTGTGGACCACCGGAAAGTTCTTAAAAGTTGCTGGTGACATTTCTTGC

Ensembl | human accession no.

ENSG00000196363

NCBI accession no.

NM_017588

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... WDR5(11091) , WDR5(11091)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Biao Ding et al.
Biology of reproduction, 96(4), 758-771 (2017-04-06)
WD repeat-containing protein 5 (WDR5), a member of conserved WD40 protein family, is an essential component of the mixed lineage leukemia (MLL) complexes, which are crucial for numerous key biological processes including methylation of histone H3 lysine 4 (H3K4), self-renewal
Xin Tan et al.
Cell death & disease, 8(3), e2686-e2686 (2017-03-17)
Colorectal cancer (CRC) is the third most common cause of cancer deaths, and has a high rate of liver and lung metastasis. Unfortunately, distant metastasis is the main barrier for advanced CRC therapy and leads to a very low survival
Bin Dai et al.
Cancer management and research, 12, 3223-3235 (2020-05-23)
Glioma is one of the important diseases that threaten human survival in today's society. WD repeat domain 5 (WDR5) belongs to the components of the lysine methyltransferase complex. WDR5 is involved in gene transcription regulation, cell senescence, cancer and other
Di Huang et al.
OncoTargets and therapy, 13, 10525-10534 (2020-10-30)
The WD40 protein family member WD repeat domain 5 (WDR5) plays significant roles in the tumorigenesis and development of multiple organ tumours. However, the correlation between WDR5 expression and oesophageal squamous cell carcinoma (ESCC) has not been elucidated. WDR5 mRNA
Qianghua Zhou et al.
Theranostics, 11(10), 4809-4824 (2021-03-24)
Purpose: Advanced prostate cancer (PCa) has limited treatment regimens and shows low response to chemotherapy and immunotherapy, leading to poor prognosis. Histone modification is a vital mechanism of gene expression and a promising therapy target. In this study, we characterized
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico