Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU109691

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Fecha estimada de envío02 de junio de 2025

Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00

Fecha estimada de envío02 de junio de 2025

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTATGAAGCCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAATGGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTCCAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGTCCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAACACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACTGTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAA

Ensembl | nº de acceso humano

ENSG00000044574

Nº de acceso NCBI

NM_005347

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HSPA5(3309) , HSPA5(3309)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
BBV
VNU
YJU
VFU
QEU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Haopeng Yang et al.
Oncotarget, 7(50), 83641-83656 (2016-11-16)
Pancreatic cancer is a highly aggressive malignancy, which is intrinsically resistant to current chemotherapies. Herein, we investigate whether bisdemethoxycurcumin (BDMC), a derivative of curcumin, potentiates gemcitabine in human pancreatic cancer cells. The result suggests that BDMC sensitizes gemcitabine by inducing
Hiroshi Kokubun et al.
International journal of molecular sciences, 21(2) (2020-01-16)
Preclinical studies have shown that exposure of the developing brain to inhalational anesthetics can cause neurotoxicity. However, other studies have claimed that anesthetics can exert neuroprotective effects. We investigated the mechanisms associated with the neurotoxic and neuroprotective effects exerted by
Patricia Dauer et al.
Molecular oncology, 12(9), 1498-1512 (2018-05-09)
Chemoresistance is a major therapeutic challenge that plays a role in the poor statistical outcomes in pancreatic cancer. Unfolded protein response (UPR) is one of the homeostasis mechanisms in cancer cells that have been correlated with chemoresistance in a number
Jingle Xi et al.
Oncology letters, 15(6), 9861-9867 (2018-05-29)
Glucose-regulated protein 78 (GRP78) is an endoplasmic reticulum stress signaling regulator with anti-apoptotic properties. It has been demonstrated to promote tumor proliferation, survival and metastasis, and to confer resistance against a large variety of therapies. CD24 is a glycosyl-phosphatidylinositol-anchored protein
Kyung-Won Park et al.
Scientific reports, 7, 44723-44723 (2017-03-24)
Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico