Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU108271

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGTGATTTCAGCATCCATGAGTTTTTGGCCACGTGCCAAGATTATCCGTATGTCATGGCAGATAGTTTACTGGATGTTTTAACAAAAGGAGGGCATTCCAGGACCCTACAAGAGATGGAGATGTCATTGCCTGAAGATGAAGGCCATACTAGGACACTTGACACAGCAAAAGAAATGGAGATTACAGAAGTAGAGCCACCAGGGCGTTTGGACTCCAGTACTCAAGACAGGCTCATAGCGCTGAAAGCAGTAACAAATTTTGGCGTTCCAGTTGAAGTTTTTGACTCTGAAGAAGCTGAAATATTCCAGAAGAAACTTGATGAGACCACCAGATTGCTCAGGGAACTCCAGGAAGCCCAGAATGAACGTTTGAGCACCAGACCCCCTCCGAACATGATCTGTCTCTTGGGTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiao-Meng Wang et al.
Journal of cellular and molecular medicine, 21(6), 1094-1105 (2016-12-14)
Bromodomain-containing protein 7 (BRD7) is a tumour suppressor that is known to regulate many pathological processes including cell growth, apoptosis and cell cycle. Endoplasmic reticulum (ER) stress-induced apoptosis plays a key role in diabetic cardiomyopathy (DCM). However, the molecular mechanism
Lena Golick et al.
Cellular and molecular life sciences : CMLS, 75(10), 1857-1869 (2017-11-12)
Reduced hepatic expression levels of bromodomain-containing protein 7 (BRD7) have been suggested to play a role in the development of glucose intolerance in obesity. However, the molecular mechanism by which BRD7 regulates glucose metabolism has remained unclear. Here, we show
Weihong Niu et al.
Journal of experimental & clinical cancer research : CR, 39(1), 30-30 (2020-02-08)
BRD7 is a tumor suppressor known to inhibit cell proliferation and cell cycle progression and initiate apoptosis in breast cancer. However, the function and underlying molecular events of BRD7 in tumor invasion and metastasis in breast cancer are not fully
Zili Zhang et al.
Redox biology, 36, 101619-101619 (2020-08-31)
Ferroptosis is a recently discovered form of programmed cell death, but its regulatory mechanisms are not fully understood. In the current study, we reported that the BRD7-P53-SLC25A28 axis played a crucial role in regulating ferroptosis in hepatic stellate cells (HSCs).

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico