Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU108151

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT5A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Check Cart for Availability
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00

Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGTGGAACCTGAAACCATTCACCACGCGGGATTTCTCCATCAGGTCCCTGGCTGACCGGCTGGGGGACCTGAGCTATCTCATCTATGTGTTTCCTGACCGCCCCAAGGATGAGGTCTTCTCCAAGTACTACACTCCTGTGCTGGCTAAAGCTGTTGATGGATATGTGAAACCACAGATCAAGCAAGTGGTCCCTGAGTTTGTGAATGCATCTGCAGATGCTGGGGGCAGCAGCGCCACGTACATGGACCAGGCCCCCTCCCCAGCTGTGTGCCCCCAGGCTCCCTATAACATGTACCCACAGAACCCTGACCATGTACTCGATCAGGATGGAGAATTCGACCTGGATGAGACCATGGATGTGGCCAGGCACGTGGAGGAACTCTTACGCCGACCAATGGACAGTCTTGACTCCCGCCTCTCGCCCCCTGCCGGTCTTTTCACCTCTGCCAGAGGCTCCCTCTCATGAATGTTTGAATCCCACGCT

Ensembl | nº de acceso humano

ENSG00000126561

Nº de acceso NCBI

NM_003152

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... STAT5A(6776) , STAT5A(6776)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
MAV
EZU
QCS
PVT
HFT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhengzheng Xiao et al.
International journal of molecular medicine, 47(1), 113-124 (2020-11-07)
As hyperprolactinemia is observed in patients with bromocriptine‑resistant prolactinoma, prolactin (PRL) has been implicated in the development of bromocriptine resistance. Since PRL primarily mediates cell survival and drug resistance via the Janus kinase‑2 (JAK2)/signal transducer and activator of transcription 5A (STAT5) signaling pathway
Sean M Holloran et al.
Molecular and cellular endocrinology, 511, 110859-110859 (2020-05-15)
Progesterone and prolactin are two key hormones involved in development and remodeling of the mammary gland. As such, both hormones have been linked to breast cancer. Despite the overlap between biological processes ascribed to these two hormones, little is known
Baosheng Wang et al.
In vitro cellular & developmental biology. Animal, 56(3), 243-252 (2020-02-23)
The prolactin/STAT5 and AKT1/mTOR pathways play a key role in milk protein transcription and translation, respectively. However, the correlation between them in bovine mammary epithelial cells remains unclear. Here, mRNA and protein expression levels of AKT1, STAT5, and mTOR and
Dharmalingam Subramaniam et al.
Cell death & disease, 11(2), 149-149 (2020-02-26)
Osteosarcoma (OS) is the most common primary bone tumor that primarily affects children and adolescents. Studies suggested that dysregulation JAK/STAT signaling promotes the development of OS. Cells treated with pimozide, a STAT5 inhibitor suppressed proliferation and colony formation and induced

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico