Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU108041

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGTGTGGACACTGCTTCAGAAAGGGAGAAGCGTTAGTGCTGCCGACCTGAGCGAGGCCGAGCCACTCACCCACATGAGCATCACCCGTCTGCATGAGCAGAAGCTGGTGCAGCATGTGGTGTCTCAGAACTGTGACGGGCTCCACCTGAGGAGTGGGCTGCCGCGCACGGCCATCTCCGAGCTCCACGGGAACATGTACATTGAAGTCTGTACCTCCTGCGTTCCCAACAGGGAGTACGTGCGGGTGTTCGATGTGACGGAGCGCACTGCCCTCCACAGACACCAGACAGGCCGGACCTGCCACAAGTGTGGGACCCAGCTGCGGGACACCATTGTGCACTTTGGGGAGAGGGGGACGTTGGGGCAGCCTTTGAACTGGGAAGCGACCGAGGCTGCCAGCAGAGCAGACACCATCCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Romain Haider et al.
Oncotarget, 8(44), 77309-77316 (2017-11-05)
Predictive biomarkers for advanced prostate cancer (PCa) are still missing. The sirtuin 7 (SIRT7) has been linked to tumorogenesis but its role in prostate cancer is poorly documented. To determine if SIRT7 can be a biomarker for aggressive prostate cancer
Bin Jia et al.
IUBMB life, 73(1), 264-272 (2020-12-17)
Oral squamous cell carcinoma (OSCC) is a common malignant cancer with unfavorable prognosis, and the epithelial-to-mesenchymal transition (EMT) is a critical contributor to OSCC metastasis. Recently, we have shown that sirtuin 7 (Sirt7) is associated with EMT and OSCC metastasis
Anne E Wyman et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L945-L958 (2017-04-08)
Pulmonary fibrosis is a severe condition with no cure and limited therapeutic options. A better understanding of its pathophysiology is needed. Recent studies have suggested that pulmonary fibrosis may be driven by accelerated aging-related mechanisms. Sirtuins (SIRTs), particularly SIRT1, SIRT3
Wang Wei et al.
American journal of cancer research, 7(9), 1788-1803 (2017-10-06)
It is still a controversy whether the role of Sirtuin 7 (SIRT7) is an oncogene or a tumor suppressor gene in cancer as SIRT7 may have different functions in different types of cancer. Particularly, the specific roles of SIRT7 in
Yingying Zhao et al.
Oncology reports, 44(3), 959-972 (2020-07-25)
Increasing evidence has indicated the roles of sirtuin 7 (SIRT7) in numerous human cancers. However, the effects and the clinical significance of SIRT7 in human lung cancer is largely unknown. The present research demonstrated that SIRT7 was increased in human

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico