Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU100991

Sigma-Aldrich

MISSION® esiRNA

targeting human L1CAM

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCTTGGGAGAAGAGAAGGGTGGGGCTTCCCTTTCGCCACAGTATGTCAGCTACAACCAGAGCTCCTACACGCAGTGGGACCTGCAGCCTGACACTGACTACGAGATCCACTTGTTTAAGGAGAGGATGTTCCGGCACCAAATGGCTGTGAAGACCAATGGCACAGGCCGCGTGAGGCTCCCTCCTGCTGGCTTCGCCACTGAGGGCTGGTTCATCGGCTTTGTGAGTGCCATCATCCTCCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jin-Cheng Guo et al.
Journal of molecular medicine (Berlin, Germany), 95(12), 1355-1368 (2017-09-25)
L1 cell adhesion molecule (L1CAM) is highly expressed in various types of human cancers, displaying yet unknown molecular mechanisms underlying their oncogenic potential. Here, we found that L1CAM expression was significantly increased in esophageal squamous cell carcinoma (ESCC; n = 157) lesions
Chaohui Zuo et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 18(3), 328-333 (2018-03-12)
To explore the molecular mechanisms of celecoxib-induced pancreatic cancer suppression in vivo and in vitro. The anti-pancreatic cancer activities of celecoxib (0, 20, 60 and 100 μmol/L) were investigated by cell viability and migration of Panc-1 and Bxpc-3 cells in vitro. The expression of L1CAM

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico