Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU100071

Sigma-Aldrich

MISSION® esiRNA

targeting human NUAK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCATCACCACAAGCACAACTTGAAGCACCGCTACGAGCTGCAGGAGACCCTGGGCAAAGGCACCTACGGCAAAGTCAAGCGGGCCACCGAGAGGTTTTCTGGCCGAGTGGTTGCTATAAAATCCATTCGTAAGGACAAAATTAAGGATGAACAAGACATGGTTCACATCAGACGAGAGATTGAGATCATGTCATCTCTCAACCATCCTCATATCATCAGTATTTATGAAGTGTTTGAGAACAAAGATAAGATTGTGATCATCATGGAATATGCCAGCAAAGGGGAGCTGTACGATTACATCAGTGAGCGGCG

Ensembl | human accession no.

ENSG00000074590

NCBI accession no.

NM_014840

shipped in

ambient

Storage temp.

−20°C

Gene Information

human ... NUAK1(9891) , NUAK1(9891)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Minghui Li et al.
American journal of translational research, 9(4), 1708-1719 (2017-05-05)
Lung cancer incidence and mortality rates are amongst the highest of all malignant tumors worldwide. ARK5 is a member of the human AMP-activated protein kinase (AMPK) family which is implicated in tumor survival and progression. The current study was designed
Ji Kui Peng et al.
Oncology letters, 15(3), 3639-3645 (2018-02-23)
Hypoxia is a common characteristic of solid tumors. Previous studies have reported that the tumor invasion-associated factor, AMPK-related protein kinase 5 (ARK5), is associated with a poor prognosis in colon cancer. However, whether or not ARK5 is involved in hypoxia
Emilia Escalona et al.
Frontiers in oncology, 10, 1123-1123 (2020-08-06)
NUAK1 is an AMPK-related kinase located in the cytosol and the nucleus, whose expression associates with tumor malignancy and poor patient prognosis in several cancers. Accordingly, NUAK1 was associated with metastasis because it promotes cell migration and invasion in different
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that
Giacomo Cossa et al.
Molecular cell, 77(6), 1322-1339 (2020-02-02)
Deregulated expression of MYC induces a dependence on the NUAK1 kinase, but the molecular mechanisms underlying this dependence have not been fully clarified. Here, we show that NUAK1 is a predominantly nuclear protein that associates with a network of nuclear

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico