Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU096711

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kai Wu et al.
The Journal of international medical research, 47(2), 893-904 (2019-01-09)
The aim of this study was to observe the effect of Ku86 on cellular senescence and apoptosis induced by various doses of ionizing radiation in human umbilical vein endothelial cells (HUVECs). Senescence-associated β-galactosidase activity was detected to evaluate cell senescence.
Damiano Fantini et al.
Molecular biology of the cell, 28(1), 192-200 (2016-12-31)
Damaged DNA-binding protein 2 (DDB2), a nuclear protein, participates in both nucleotide excision repair and mRNA transcription. The transcriptional regulatory function of DDB2 is significant in colon cancer, as it regulates metastasis. To characterize the mechanism by which DDB2 participates
Katerina Jerabkova et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12751-12767 (2020-08-02)
Equal segregation of chromosomes during mitosis ensures euploidy of daughter cells. Defects in this process may result in an imbalance in the chromosomal composition and cellular transformation. Proteolytic and non-proteolytic ubiquitylation pathways ensure directionality and fidelity of mitotic progression but
Kristen E Mengwasser et al.
Molecular cell, 73(5), 885-899 (2019-01-29)
BRCA1 or BRCA2 inactivation drives breast and ovarian cancer but also creates vulnerability to poly(ADP-ribose) polymerase (PARP) inhibitors. To search for additional targets whose inhibition is synthetically lethal in BRCA2-deficient backgrounds, we screened two pairs of BRCA2 isogenic cell lines
Prashant Rai et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(26), E3421-E3430 (2015-06-17)
Streptococcus pneumoniae is a leading cause of pneumonia and one of the most common causes of death globally. The impact of S. pneumoniae on host molecular processes that lead to detrimental pulmonary consequences is not fully understood. Here, we show

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico