Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU096271

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB4A (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATTGGAAATGCAGGAACTGGCAAATCTTGCTTACTTCATCAGTTTATTGAAAAAAAATTCAAAGATGACTCAAATCATACAATAGGAGTGGAATTTGGTTCAAAGATAATAAATGTTGGTGGTAAATATGTAAAGTTACAAATATGGGATACAGCAGGACAAGAACGATTCAGGTCCGTGACGAGAAGTTATTACCGAGGCGCGGCCGGGGCTCTCCTCGTCTATGATATCACCAGCCGAGAAACCTACAATGCGCTTACTAATTGGTTAACAGATGCCCGAATGCTAGCGAGCCAGAACAT

Ensembl | nº de acceso humano

ENSG00000168118

Nº de acceso NCBI

NM_004578

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RAB4A(5867) , RAB4A(10638)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tom Flossmann et al.
Cell reports, 26(12), 3173-3182 (2019-03-21)
Synchronized activity is a universal characteristic of immature neural circuits that is essential for their developmental refinement and strongly depends on GABAergic neurotransmission. A major subpopulation of GABA-releasing interneurons (INs) expresses somatostatin (SOM) and proved critical for rhythm generation in
Arthur H Cheng et al.
Cell reports, 26(12), 3191-3202 (2019-03-21)
Clock neurons within the mammalian suprachiasmatic nuclei (SCN) encode circadian time using interlocked transcription-translation feedback loops (TTFLs) that drive rhythmic gene expression. However, the contributions of other transcription factors outside of the circadian TTFLs to the functionality of the SCN

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico