Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU095461

Sigma-Aldrich

MISSION® esiRNA

targeting human CCL20

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAAAAACTGTGGCTTTTCTGGAATGGAATTGGACATAGCCCAAGAACAGAAAGAACCTTGCTGGGGTTGGAGGTTTCACTTGCACATCATGGAGGGTTTAGTGCTTATCTAATTTGTGCCTCACTGGACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li-Shang Liao et al.
Aging, 12(14), 14849-14862 (2020-06-24)
Recent evidence suggests that CC chemokine ligand 20 (CCL20) is upregulated after subarachnoid hemorrhage (SAH). Here, we investigated the functions of CCL20 in SAH injury and its underlying mechanisms of action. We found that CCL20 is upregulated in an SAH
Qiang Fu et al.
Biotechnology letters, 43(2), 393-405 (2020-11-10)
Myocardial infarction (MI) is a prevalent cardiovascular puzzle and a mainspring of disease-induced mortality. We performed this investigation to detect the role of putative important miRNAs or genes in MI. CCL20 may be a potential therapeutic target, which was directly
Masaaki Murakami et al.
The Journal of experimental medicine, 208(1), 103-114 (2011-01-12)
Cognate antigen recognition by CD4(+) T cells is thought to contribute to the tissue specificity of various autoimmune diseases, particularly those associated with class II MHC alleles. However, we show that localized class II MHC-dependent arthritis in F759 mice depends

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico