Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU094941

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPD (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuhong Sun et al.
The Journal of biological chemistry, 291(50), 25823-25836 (2016-10-28)
Autotaxin (ATX) is a key enzyme that converts lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a lysophospholipid mediator that regulates cellular activities through its specific G protein-coupled receptors. The ATX-LPA axis plays an important role in various physiological and pathological processes
Luigi Alfano et al.
Nucleic acids research, 47(8), 4068-4085 (2019-02-26)
DNA double strand break (DSB) repair through homologous recombination (HR) is crucial to maintain genome stability. DSB resection generates a single strand DNA intermediate, which is crucial for the HR process. We used a synthetic DNA structure, mimicking a resection
Huiwen Song et al.
Autophagy, 15(8), 1419-1437 (2019-03-15)
N6-methyladenosine (m6A) mRNA modifications play critical roles in various biological processes. However, no study addresses the role of m6A in macroautophagy/autophagy. Here, we show that m6A modifications are increased in H/R-treated cardiomyocytes and ischemia/reperfusion (I/R)-treated mice heart. We found that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico