Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU094471

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCTGACCAAGACAGTGAAGGATGCTGTACAGAAGAACTCAGAGAAGTACCTGAGCGAGCTCGCAGAGCAGCCTGAGCGCAAGATCACTCGCAACCAAAAGCGCAAGCATGATGAGATCAACCATGTGCAGAAGACTTATGCAGAGATGGACCCCACCACAGCAGCCTTGGAGAAGGAGCATGAGGCGATCACCAAGGTGAAGTATGTGGACAAGATCCACATCGGGAACTACGAAATTGATGCCTGGTATTTCTCACCATTCCCCGAAGACTATGGGAAACAGCCCAAGCTCTGGCTCTGCGAGTACTGCCTCAAGTACATGAAATATGAGAAGAGCTACCGCTTCCACTTGGGTCAGTGCCAGTGGCGGCAGCCCCCCGGGAAAGAGATCTACCGCAAGAGCAACATCTCCGTGTACGAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jin Zhang et al.
Biochemical and biophysical research communications, 452(3), 575-580 (2014-09-03)
Males absent on the first (MOF) is a histone acetyltransferase belongs to the MYST (MOZ, Ybf2/Sas3, Sas2 and TIP60) family. In mammals, MOF plays critical roles in transcription activation by acetylating histone H4K16, a prevalent mark associated with chromatin decondensation.
Zhiwei Chen et al.
British journal of pharmacology, 171(13), 3196-3211 (2014-02-28)
The histone acetyltransferase MOF is a member of the MYST family. In mammals, MOF plays critical roles by acetylating histone H4 at K16 and non-histone substrates such as p53. Here we have investigated the role of MOF in human lung

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico