Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

EHU093291

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human IRAK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCCTCCAGAAAGTCGAGCAGCACCCACCTCCAACCTCGGGCCAGTGTCTTCAGGCTTTACTGGGGACCTGCGAGCTGGCCTAATGTGGTGGCCTGCAAGCCAGGCCATCCCTGGGCGCCACAGACGAGCTCCGAGCCAGGTCAGGCTTCGGAGGCCACAAGCTCAGCCTCAGGCCCAGGCACTGATTGTGGCAGAGGGGCCACTACCCAAGGTCTAGCTAGGCCCAAGACCTAGTTACCCAGACAGTGAGAAGCCCCTGGAAGGCAGAAAAGTTGGGAGCATGGCAGACAGGGAAGGGAAACATTTTCAGGGAAAAGACATGTATCACATGTCTTCAGAAGCAAGTCAGGTTTCATGTAACCGAGTGTCCTCTTGCGTGTCCAAAAGTAGCCCAGGGCTGTAGCACAGGCTTCACAGTGATT

Ensembl | nº de acceso humano

ENSG00000184216

Nº de acceso NCBI

NM_001569

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IRAK1(3654) , IRAK1(3654)

Categorías relacionadas

MISSION® esiRNA

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

ZST

NRR

RPR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Downregulation of IRAK1 Prevents the Malignant Behavior of Hepatocellular Carcinoma Cells by Blocking Activation of the MAPKs/NLRP3/IL-1β Pathway.

Wei Chen et al.

OncoTargets and therapy, 13, 12787-12796 (2020-12-29)

Interleukin-1 receptor-associated kinase 1 (IRAK1) was shown to contribute to a variety of cancer-related processes. However, the function of IRAK1 in hepatocellular carcinoma (HCC) pathogenesis has not been investigated in detail. IRAK1 expression in HCC was examined by immunohistochemistry, qRT-PCR

Effects of interleukin-1 receptor-associated kinase 1 RNA interference in dendritic cells on inflammatory cytokine release and T-cell proliferation.

Yan Gao et al.

Molecular medicine reports, 14(6), 5685-5692 (2016-11-24)

The present study aimed to reduce the expression of interleukin-1 receptor-associated kinase 1 (IRAK-1) in dendritic cells (DCs) by RNA interference (RNAi). Subsequently, its effects on the expression of costimulatory surface molecules, the release of inflammatory cytokines, and the proliferation of

MicroRNA-146a Promotes Oligodendrogenesis in Stroke.

Xian Shuang Liu et al.

Molecular neurobiology, 54(1), 227-237 (2016-01-08)

Stroke induces new myelinating oligodendrocytes that are involved in ischemic brain repair. Molecular mechanisms that regulate oligodendrogenesis have not been fully investigated. MicroRNAs (miRNAs) are small non-coding RNA molecules that post-transcriptionally regulate gene expression. MiR-146a has been reported to regulate

Prenatal low-dose endotoxin exposure prolongs intestinal epithelial activation after birth and contributes to necrotizing enterocolitis.

Hong-Yi Zhang et al.

Journal of pediatric surgery, 55(11), 2308-2316 (2020-04-24)

To investigate the effects of low dose endotoxin on transcriptional activity in intestinal epithelium, and its role in necrotizing enterocolitis (NEC). Lipopolysaccharides (LPS) were injected into the amniotic cavity of pregnant mice under ultrasound guidance. The effects of LPS on

Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Induces Interleukin-17 Production via Activation of the IRAK1-PI3K-p38MAPK-C/EBPβ/CREB Pathways.

Honglei Wang et al.

Journal of virology, 93(21) (2019-08-16)

Porcine reproductive and respiratory syndrome virus (PRRSV) is widely prevalent in pigs, resulting in significant economic losses worldwide. A compelling impact of PRRSV infection is severe pneumonia. In the present study, we found that interleukin-17 (IL-17) was upregulated by PRRSV

Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico