Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU092501

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACATGGACCTGCGCTTCCAGGTCCTGGAGACCGCCAGCTACAATGGAGTGCTCATCTGGAAGATTCGCGACTACAAGCGGCGGAAGCAGGAGGCCGTCATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTCTACACTGGTTACTTTGGCTATAAGATGTGTGCCAGGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGACGCACTTGTCGCTGTTTTTTGTCATCATGCGTGGAGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCAGAAAGTGACACTCATGCTGATGGATCAGGGGTCCTCTCGACGTCATTTGGGAGATGCATTCAAGCCCGACCCCAACAGCAGCAGCTTCAAGAAGCCCACTGGAGAGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGGCCCAAACTGT

Ensembl | human accession no.

ENSG00000131323

NCBI accession no.

NM_003300

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRAF3(7187) , TRAF3(7187)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Liping Sun et al.
IUBMB life, 69(3), 170-178 (2017-02-12)
This study aims to investigate the effects of TNF receptors associated factor 3 (TRAF3) on the signaling pathway and expression of downstream products of nuclear factor kappa B (NF-κB) in the epithelial cells of renal ducts in individuals with polycystic
Peng Li et al.
Brain, behavior, and immunity, 79, 174-185 (2019-02-04)
Neuroinflammation occurs after germinal matrix hemorrhage (GMH) and induces secondary brain injury. Interferon-α (IFN-α) has been shown to exert anti-inflammatory effects in infectious diseases via activating IFNAR and its downstream signaling. We aimed to investigate the anti-inflammatory effects of Recombinant
Hongzhi Sun et al.
International immunopharmacology, 88, 106691-106691 (2020-08-22)
Acute pancreatitis (AP) is an inflammatory disease with high morbidity and mortality. Dysregulation of microRNAs (miRNAs) was involved in human diseases, including AP. However, the effects of miR-92b-3p on AP process and its mechanism remain not been fully clarified. The
Yanhua Zhao et al.
Experimental diabetes research, 2011, 192564-192564 (2011-08-27)
The impact of increased NF-κB-inducing kinase (NIK), a key component of the NF-κB activation pathways, on diabetes-induced renal inflammation remains unknown. We overexpressed NIK wild type (NIKwt) or kinase-dead dominant negative mutants (NIKdn) in HK-2 cells and demonstrated that RelB
Shengtao Yao et al.
Neuropsychiatric disease and treatment, 12, 3083-3092 (2016-12-17)
Ischemic stroke is one of the leading causes of brain disease, with high morbidity, disability, and mortality. MicroRNAs (miRNAs) have been identified as vital gene regulators in various types of human diseases. Accumulating evidence has suggested that aberrant expression of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico