Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU091961

Sigma-Aldrich

MISSION® esiRNA

targeting human FLI1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGGACACAGGAGCATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAGATCGACACATCCTTTTTCCAGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAGGACTTCCTCCGCGCCACCACCCTCTACAACACGGAAGTGCTGTTGTCACACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTTGGGGCAATAACATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAATACAGAGCAACGGCC

Ensembl | nº de acceso humano

ENSG00000151702

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FLI1(2313) , FLI1(2313)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jonathan P Van Beek et al.
Arthritis research & therapy, 8(2), R36-R36 (2006-02-14)
CCN2 is encoded by an immediate-early gene induced in mesenchymal cells during the formation of blood vessels, bone and connective tissue. It plays key roles in cell adhesion and migration, as well as matrix remodeling. CCN2 is overexpressed in fibrosis
Tao He et al.
Gene, 596, 137-146 (2016-10-30)
A translocation leading to the formation of an oncogenic EWS-ETS fusion protein defines Ewing sarcoma. The most frequent gene fusion, present in 85 percent of Ewing sarcomas, is EWS-FLI1. Here, a high-throughput RNA interference screen was performed to identify genes
Takuya Miyagawa et al.
Rheumatology (Oxford, England), 59(8), 2005-2015 (2019-11-30)
Adipsin, or complement factor D, is a serine proteinase catalysing complement factor C3 breakdown, leading to the production of opsonin (C3b), membrane attack complex (C5b-C9) and anaphylatoxins (C3a and C5a). Since adipsin is potentially associated with pulmonary arterial hypertension in
Beiping Miao et al.
International journal of cancer, 147(1), 189-201 (2019-12-18)
Binding of transcription factors to mutated DNA sequences is a likely regulator of cancer progression. Noncoding regulatory mutations such as those on the core promoter of the gene encoding human telomerase reverse transcriptase have been shown to affect gene expression
Gong-Hong Wei et al.
The EMBO journal, 29(13), 2147-2160 (2010-06-03)
Members of the large ETS family of transcription factors (TFs) have highly similar DNA-binding domains (DBDs)-yet they have diverse functions and activities in physiology and oncogenesis. Some differences in DNA-binding preferences within this family have been described, but they have
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico