Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU088861

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGA6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTCTTCATTTGGCTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGGCAAGATATAGTTATTGGAGCCCCACAGTATTTTGATAGAGATGGAGAAGTTGGAGGTGCAGTGTATGTCTACATGAACCAGCAAGGCAGATGGAATAATGTGAAGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGCATTGCAGTAAAAAATATTGGAGATATTAATCAAGATGGCTACCCAGATATTGCAGTTGGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chunbo He et al.
Cell reports, 26(10), 2636-2650 (2019-03-07)
HPV infections are common in healthy women and only rarely cause cervical cancer, suggesting that individual genetic susceptibility may play a critical role in the establishment of persistent HPV infection and the development of cervical cancer. Here, we provide convincing in vitro
Daiane Cristina F Golbert et al.
Cell adhesion & migration, 12(2), 152-167 (2017-05-12)
The thymus supports differentiation of T cell precursors. This process requires relocation of developing thymocytes throughout multiple microenvironments of the organ, mainly with thymic epithelial cells (TEC), which control intrathymic T cell differentiation influencing the formation and maintenance of the
Nan Liu et al.
Nature, 568(7752), 344-350 (2019-04-05)
Stem cells underlie tissue homeostasis, but their dynamics during ageing-and the relevance of these dynamics to organ ageing-remain unknown. Here we report that the expression of the hemidesmosome component collagen XVII (COL17A1) by epidermal stem cells fluctuates physiologically through genomic/oxidative
Miyeon Kim et al.
Stem cells international, 2020, 5924983-5924983 (2020-05-14)
Mesenchymal stem cells (MSCs) represent a promising means to promote tissue regeneration. However, the heterogeneity of MSCs impedes their use for regenerative medicine. Further investigation of this phenotype is required to develop cell therapies with improved clinical efficacy. Here, a
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico