Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU087231

Sigma-Aldrich

MISSION® esiRNA

targeting human BACE1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACATTGCTGCCATCACTGAATCAGACAAGTTCTTCATCAACGGCTCCAACTGGGAAGGCATCCTGGGGCTGGCCTATGCTGAGATTGCCAGGCCTGACGACTCCCTGGAGCCTTTCTTTGACTCTCTGGTAAAGCAGACCCACGTTCCCAACCTCTTCTCCCTGCAGCTTTGTGGTGCTGGCTTCCCCCTCAACCAGTCTGAAGTGCTGGCCTCTGTCGGAGGGAGCATGATCATTGGAGGTATCGACCACTCGCTGTACACAGGCAGTCTCTGGTATACACCCATCCGGCGGGAGTGGTATTATGAGGTGATCATTGTGCGGGTGGAGATCAATGGACAGGATCTGAAAATGGACTGCAAGGAGTACAACTATGACAAGAGCATTGTGGACAGTGGCACCACCAACCTTCGTTTGCCCAAGAAAGTGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nan Zhang et al.
Neuroreport, 31(3), 205-212 (2019-12-27)
Alzheimer's disease is the most common neurodegenerative disease, characterized by accumulation of amyloid β peptides. MicroRNAs have been identified as significant regulators and therapeutic targets of Alzheimer's disease. However, the roles of miR-16-5p and miR-19b-3p and their mechanisms in Alzheimer's
Chi Zhang et al.
Current pharmaceutical biotechnology, 20(1), 56-62 (2019-02-08)
To deliver drugs to treat Alzheimer's Disease (AD), nanoparticles should firstly penetrate through blood brain barrier, and then target neurons. Recently, we developed an Apo A-I and NL4 dual modified nanoparticle (ANNP) to deliver beta-amyloid converting enzyme 1 (BACE1) siRNA.
Pengzhen Wang et al.
Journal of controlled release : official journal of the Controlled Release Society, 279, 220-233 (2018-04-22)
β-site amyloid precursor protein cleaving enzyme 1 (BACE1) is a key enzyme to cleave the amyloid precursor protein to develop Alzheimer's disease (AD). Reducing BACE1 expression in central neuron through RNA interference technology shows great promise to overcome AD. However
Xiaoyao Zheng et al.
Acta biomaterialia, 49, 388-401 (2016-11-16)
To realize the therapeutic potential of gene drugs for Alzheimer's disease (AD), non-invasive, tissue-specific and efficient delivery technologies must be developed. Here, a hybrid system for amyloid plaques targeted siRNA delivery was formed by PEGylated Poly(2-(N,N-dimethylamino) ethyl methacrylate) (PEG-PDMAEMA) conjugated
Sujoy Bera et al.
EMBO reports, 21(6), e47954-e47954 (2020-04-24)
Cleavage of amyloid precursor protein (APP) by BACE-1 (β-site APP cleaving enzyme 1) is the rate-limiting step in amyloid-β (Aβ) production and a neuropathological hallmark of Alzheimer's disease (AD). Despite decades of research, mechanisms of amyloidogenic APP processing remain highly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico