Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU085291

Sigma-Aldrich

MISSION® esiRNA

targeting human JMJD6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTGTTGAATGCGCAAGAGGGCTGGTCTGCGCAGGAGAAATGGACTCTGGAGCGCCTAAAAAGGAAATATCGGAACCAGAAGTTCAAGTGTGGTGAGGATAACGATGGCTACTCAGTGAAGATGAAGATGAAATACTACATCGAGTACATGGAGAGCACTCGAGATGATAGTCCCCTTTACATCTTTGACAGCAGCTATGGTGAACACCCTAAAAGAAGGAAACTTTTGGAAGACTACAAGGTGCCAAAGTTTTTCACTGATGACCTTTTCCAGTATGCTGGGGAGAAGCGCAGGCCCCCTTACAGGTGGTTTGTGATGGGGCCACCACGCTCCGGAACTGGGATTCACATCGACCCTCTGGGAACCAGTGCCTGGAATGCCTTAGTTCAGGGCCACAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chang-Ryul Lee et al.
Carcinogenesis, 37(2), 119-128 (2015-12-10)
Cancer stem cells (CSCs) are defined as a small subpopulation of cancer cells within a tumor and responsible for initiation and maintenance of tumor growth. Thus, understanding of molecular regulators of CSCs is of paramount importance for the development of
Alec Paschalis et al.
Cancer research, 81(4), 1087-1100 (2021-04-07)
Endocrine resistance (EnR) in advanced prostate cancer is fatal. EnR can be mediated by androgen receptor (AR) splice variants, with AR splice variant 7 (AR-V7) arguably the most clinically important variant. In this study, we determined proteins key to generating
Yan Liu et al.
Oncogene, 38(7), 980-997 (2018-09-07)
Overexpression of Jumonji domain-containing 6 (JMJD6) has been reported to be associated with more aggressive breast cancer characteristics. However, the precise role of JMJD6 in breast cancer development remains unclear. Here, we demonstrate that JMJD6 has intrinsic tyrosine kinase activity

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico