Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU083931

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB16

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCACCCCTACGAGTGTGAGTTCTGTGGCAGCTGCTTCCGGGATGAGAGCACACTCAAGAGCCACAAACGCATCCACACGGGTGAGAAACCCTACGAGTGCAATGGCTGTGGCAAGAAGTTCAGCCTCAAGCATCAGCTGGAGACGCACTATAGGGTGCACACAGGTGAGAAGCCCTTTGAGTGTAAGCTCTGCCACCAGCGCTCCCGGGACTACTCGGCCATGATCAAGCACCTGAGAACGCACAACGGCGCCTCGCCCTACCAGTGCACCATCTGCACAGAGTACTGCCCCAGCCTCTCCTCCATGCAGAAGCACATGAAGGGCCACAAGCCCGAGGAGATCCCGCCCGACTGGAGGATAGAGAAGACGTACCTCTACCTGTGCTATGTGTGAAGGGAGGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wencong Song et al.
Journal of cellular biochemistry, 116(10), 2155-2165 (2015-03-27)
The balance between the self-renewal and differentiation of male germline stem cells (mGSCs) is critical for the initiation and maintenance of mammalian spermatogenesis. The promyelocytic leukemia zinc finger (PLZF), a zinc finger protein, is a critical factor for maintaining the
Yung-Ho Hsu et al.
PloS one, 7(1), e30674-e30674 (2012-02-01)
Many studies suggest that far-infrared (FIR) therapy can reduce the frequency of some vascular-related diseases. The non-thermal effect of FIR was recently found to play a role in the long-term protective effect on vascular function, but its molecular mechanism is
Wencheng Kong et al.
Aging, 12(23), 24009-24022 (2020-11-23)
Peritoneal metastasis (PM) is the main cause of poor prognosis in patients with advanced gastric cancer (GC). Increasing evidence has suggested that cancer-associated EVs in body fluids may assist in the diagnosis and treatment of GC. Here, we investigated the
Julien M D Legrand et al.
Nature communications, 10(1), 2278-2278 (2019-05-28)
Mammalian spermatogenesis is sustained by mitotic germ cells with self-renewal potential known as undifferentiated spermatogonia. Maintenance of undifferentiated spermatogonia and spermatogenesis is dependent on tightly co-ordinated transcriptional and post-transcriptional mechanisms. The RNA helicase DDX5 is expressed by spermatogonia but roles

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico