Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU081321

Sigma-Aldrich

MISSION® esiRNA

targeting human BDNF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTATCAGAAAGCCCCAAGCAATTGCTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAGAATTTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACTTTACGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAATATCTGCTGTATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAAGGATTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

L Gao et al.
Neoplasma, 65(1), 89-96 (2018-01-13)
Recent studies have confirmed the existence of BDNF and tropomyosin-related kinase B (TrkB) in normal and cancerous urothelium. However, the corresponding mechanisms and upstream signal pathways of BDNF/TrkB have not been fully discovered. This study aimed to investigate the effects
E Bouvier et al.
Molecular psychiatry, 22(12), 1701-1713 (2016-09-21)
Stressful life events produce a state of vulnerability to depression in some individuals. The mechanisms that contribute to vulnerability to depression remain poorly understood. A rat model of intense stress (social defeat (SD), first hit) produced vulnerability to depression in
Yu-Pu Liu et al.
Frontiers in neuroscience, 14, 525144-525144 (2020-11-03)
Growing evidence indicates that electroacupuncture (EA) has a definite effect on the treatment of peripheral nerve injury (PNI), but its mechanism is not completely clear. MicroRNAs (miRNAs) are involved in the regulation of a variety of biological processes, and EA
Abdelrahman Y Fouda et al.
Molecular neurobiology, 54(1), 661-670 (2016-01-14)
Angiotensin type 1 receptor blockers (ARBs) have been shown to be neuroprotective and neurorestorative in experimental stroke. The mechanisms proposed include anti-inflammatory, antiapoptotic effects, as well as stimulation of endogenous trophic factors leading to angiogenesis and neuroplasticity. We aimed to
So Yoon Ahn et al.
Cell transplantation, 26(1), 145-156 (2016-08-19)
Mesenchymal stem cell (MSC) transplantation protects against neonatal severe intraventricular hemorrhage (IVH)-induced brain injury by a paracrine rather than regenerative mechanism; however, the paracrine factors involved and their roles have not yet been delineated. This study aimed to identify the

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico