Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU080431

Sigma-Aldrich

MISSION® esiRNA

targeting human NCL

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Aplicación

MISSION® esiRNA has been used for transfection of cells to target nucleolin.

Acciones bioquímicas o fisiológicas

NCL (nucleolin) is ribonucleoprotein, mainly involved in ribosomal biogenesis. Additionally, it is linked with cell differentiation and proliferation, stress-conditioned responses and cellular shuttling. This gene is upregulated in cancer cells. In cancer cells, it is associated with progression and is mainly present on the membrane of cancer cells. On the membrane, it binds to tumor promoting proteins.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nucleolin antagonist triggers autophagic cell death in human glioblastoma primary cells and decreased in vivo tumor growth in orthotopic brain tumor model.
Benedetti E
Oncotarget, 6, 42091-42091 (2015)
Nucleolin-binding by ErbB2 enhances tumorigenicity of ErbB2-positive breast cancer.
Wolfson E
Oncotarget, 7, 65320-65320 (2016)
Fengfei Wang et al.
Journal of the American Chemical Society, 141(8), 3613-3622 (2019-01-29)
The aim of this study is to illuminate a novel therapeutic approach by identifying a functional binding target of salinomycin, an emerging anticancer stem cell (CSC) agent, and to help dissect the underlying action mechanisms. By utilizing integrated strategies, we
Quantitative Cell Cycle Analysis Based on an Endogenous All-in-One Reporter for Cell Tracking and Classification.
Zerjatke T
Cell Reports, 19, 1953-1953 (2017)
Zoi Diamantopoulou et al.
Oncotarget, 8(52), 90108-90122 (2017-11-23)
In this study, a novel anticancer reagent based on polyplexes nanoparticles was developed. These nanoparticles are obtained by mixing negatively charged polyelectrolytes with the antitumour cationically-charged pseudopeptide N6L. Using two

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico