Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU078371

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP7B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAAGGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTGGAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACCTTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGTTTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCTTGCTTGGGGAATGTTGTT

Ensembl | nº de acceso humano

ENSG00000123191

Nº de acceso NCBI

NM_000053

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ATP7B(540) , ATP7B(540)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DSU
HHU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junko Fujiyoshi et al.
Scientific reports, 9(1), 1535-1535 (2019-02-09)
Wilson's disease (WD) is an inherited metabolic disease arising from ATPase copper transporting beta gene (ATP7B) mutation. Orthotoropic liver transplantation is the only radical treatment of fulminant WD, although appropriate donors are lacking at the onset of emergency. Given the
Navasona Krishnan et al.
Genes & development, 32(13-14), 944-952 (2018-06-28)
The levels of copper, which is an essential element in living organisms, are under tight homeostatic control. Inactivating mutations in ATP7B, a P-type Cu-ATPase that functions in copper excretion, promote aberrant accumulation of the metal, primarily the in liver and
Marta Mariniello et al.
Cancers, 12(3) (2020-03-12)
Tumor resistance to chemotherapy represents an important challenge in modern oncology. Although platinum (Pt)-based drugs have demonstrated excellent therapeutic potential, their effectiveness in a wide range of tumors is limited by the development of resistance mechanisms. One of these mechanisms
Xue Fu et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 432-451 (2014-03-13)
Regulation of cellular copper (Cu) homeostasis involves Cu-transporting ATPases (Cu-ATPases), i.e., ATP7A and ATP7B. The question as to how these Cu-ATPases in brain barrier systems transport Cu, i.e., toward brain parenchyma, cerebrospinal fluid (CSF), or blood, remained unanswered. This study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico