Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU078251

Sigma-Aldrich

MISSION® esiRNA

targeting human CTH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATTCGAAAGCCTTGCTGAGCTTCCGGCAATCATGACTCATGCATCAGTTCTTAAGAATGACAGAGATGTCCTTGGAATTAGTGACACACTGATTCGACTTTCTGTGGGCTTAGAGGATGAGGAAGACCTACTGGAAGATCTAGATCAAGCTTTGAAGGCAGCACACCCTCCAAGTGGAAGTCACAGCTAGTATTCCAGAGCTGCTATTAGAAGCTGCTTCCTGTGAAGATCAAATCTTCCTGAGTAATTAAATGGACCAACAATGAGCCTTTGCAAAATTTTCAAGCGGAAATTTTAAGGCACCTCATTATCTTTCATAACTGTAATTTTCTTAGGGATCATCTCTGTTAAAAAGTTTTCTGTATGTCATGTTATAATTACAGGTCAATTCTGTTAATATCTTTTTGTTAATTTTGCTCTATGTTTGCCTCTGAAGGAGGT

Ensembl | nº de acceso humano

ENSG00000116761

Nº de acceso NCBI

NM_001902

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CTH(1491) , CTH(1491)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
SNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Neil Dufton et al.
Scientific reports, 2, 499-499 (2012-07-13)
Hydrogen sulfide is an essential gasotransmitter associated with numerous pathologies. We assert that hydrogen sulfide plays an important role in regulating macrophage function in response to subsequent inflammatory stimuli, promoting clearance of leukocyte infiltrate and reducing TNF-α levels in vivo
Zhongjian Cheng et al.
Circulation, 134(19), 1467-1483 (2016-09-24)
Bone marrow cell (BMC)-based treatment for critical limb ischemia in diabetic patients yielded a modest therapeutic effect resulting from cell dysfunction. Therefore, approaches that improve diabetic stem/progenitor cell functions may provide therapeutic benefits. Here, we tested the hypothesis that restoration
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has
Tian-Xiao Hu et al.
Placenta, 52, 33-40 (2017-04-30)
Increased production of soluble fms-like tyrosine kinase-1 (sFlt-1) from placenta is one of the major contributors to the development of preeclampsia. Our previous study has shown that hydrogen sulfide (H
Lissette Carolina Sanchez-Aranguren et al.
Scientific reports, 10(1), 15810-15810 (2020-09-27)
Endothelial dysfunction is a hallmark of preeclampsia, a life-threatening complication of pregnancy characterised by hypertension and elevated soluble Fms-Like Tyrosine Kinase-1 (sFlt-1). Dysregulation of hydrogen sulfide (H2S) by inhibition of cystathionine γ-lyase (CSE) increases sFlt-1 and soluble endoglin (sEng) release.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico