Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU075271

Sigma-Aldrich

MISSION® esiRNA

targeting human TNIP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGTGAGCTGCTGGAAGTGAACAAGCAGTGGGACCAGCATTTCCGGTCCATGAAGCAGCAGTATGAGCAGAAGATCACTGAGCTGCGTCAGAAGCTGGCTGATTTGCAGAAGCAGGTGACTGACCTGGAGGCCGAGCGGGAGCAGAAGCAGCGTGACTTTGACCGCAAGCTCCTCCTGGCCAAGTCCAAGATTGAAATGGAGGAGGCAAGTACCGACAAGGAGCAGCTGACAGCAGAGGCCAAGGAGCTGCGCCAAAAGGTCAAGTACCTGCAGGATCAGCTGAGCCCACTCACCCGACAGCGTGAGTACCAGGAAAAGGAGATCCAGCGGCTCAACAAGGCCCTGGAGGAAGCACTGAGCATCCAAACCCCGCCATCATCTCCACCAACAGCATTTGGGAGCCCAGAAGGAGCAGGGGCCCTCCTAAGGAAACAGGAGCTGGTCA

Ensembl | nº de acceso humano

ENSG00000145901

Nº de acceso NCBI

NM_006058

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TNIP1(10318) , TNIP1(10318)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WUU
UWR
KAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rambon Shamilov et al.
Mediators of inflammation, 2020, 5919150-5919150 (2020-05-08)
TNIP1 protein is a widely expressed, cytoplasmic inhibitor of inflammatory signaling initiated by membrane receptors such as TLRs which recognize pathogen-associated and damage-associated molecular patterns (PAMPs and DAMPs). Keratinocyte TNIP1 deficiency sensitizes cells to PAMPs and DAMPs promoting hyperresponsive expression
Ellen M Westerhout et al.
Nucleic acids research, 33(2), 796-804 (2005-02-03)
HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. However, HIV-1 escape variants emerged after prolonged culturing. These RNAi-resistant viruses contain nucleotide substitutions or deletions in or near the targeted sequence. We observed
Lilla Erdei et al.
Frontiers in immunology, 9, 2155-2155 (2018-10-16)
Human skin cells recognize the presence of the skin microbiome through pathogen recognition receptors. Epidermal keratinocytes are known to activate toll-like receptors (TLRs) 2 and 4 in response to the commensal Cutibacterium acnes (C. acnes, formerly known as Propionibacterium acnes)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico