Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU068691

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCAL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTTTGCTGAGCTGTTTTGGAACCCAGGGGTGCTGATCCAGGCTGAGGACCGCGTGCACCGCATTGGACAGACCAGCTCCGTGGGCATTCACTACCTCGTGGCAAAGGGCACAGCTGATGACTACCTTTGGCCCCTGATTCAAGAGAAGATTAAAGTTCTGGCAGAAGCCGGGCTTTCTGAGACCAATTTTTCAGAAATGACAGAATCCACTGATTACCTCTACAAGGACCCAAAGCAGCAGAAGATCTACGACCTATTCCAGAAGTCCTTTGAGAAAGAAGGAAGTGATATGGAGCTCCTGGAAGCAGCAGAGTCCTTTGACCCAGGAAGTGCTTCAGGAACATCTGGAAGTAGTTCCCAGAACATGGGAGACACCCTGGATGAAAGCTCATTGACAGCCAGTCCACAGAAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Annabel Quinet et al.
Molecular cell, 77(3), 461-474 (2019-11-05)
Acute treatment with replication-stalling chemotherapeutics causes reversal of replication forks. BRCA proteins protect reversed forks from nucleolytic degradation, and their loss leads to chemosensitivity. Here, we show that fork degradation is no longer detectable in BRCA1-deficient cancer cells exposed to
Angelo Taglialatela et al.
Molecular cell, 68(2), 414-430 (2017-10-21)
To ensure the completion of DNA replication and maintenance of genome integrity, DNA repair factors protect stalled replication forks upon replication stress. Previous studies have identified a critical role for the tumor suppressors BRCA1 and BRCA2 in preventing the degradation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico