Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU064581

Sigma-Aldrich

MISSION® esiRNA

targeting human ALKBH3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAGACCTGGAAGAACAAAGAGCATCATCTCTCTGACAGAGAGTTTGTGTTCAAAGAACCTCAGCAGGTAGTACGTAGAGCTCCTGAGCCACGAGTGATTGACAGAGAGGGTGTGTATGAAATCAGCCTGTCACCCACAGGTGTATCTAGGGTCTGTTTGTATCCTGGCTTTGTTGACGTGAAAGAAGCTGACTGGATATTGGAACAGCTTTGTCAAGATGTTCCCTGGAAACAGAGGACTGGCATCAGAGAGGATATAACTTATCAGCAACCAAGACTTACAGCATGGTATGGAGAACTTCCTTACACTTATTCAAGAATCACTATGGAACCAAATCCTCACTGGCACCCTGTGCTGCGCACACTAAAGAACCGCATTGAAGAGAACACTGGCCACACCTTCAACTCCTTACTCTGCAATCTTTATCGCAATGAGAAGGACAGCGTGGACTGGCACAGTGATGATG

Ensembl | nº de acceso humano

ENSG00000166199

Nº de acceso NCBI

NM_139178

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ALKBH3(221120) , ALKBH3(221120)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
JRR
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuko Ueda et al.
Scientific reports, 7, 42271-42271 (2017-02-17)
The mammalian AlkB homolog (ALKBH) family of proteins possess a 2-oxoglutarate- and Fe(II)-dependent oxygenase domain. A similar domain in the Escherichia coli AlkB protein catalyzes the oxidative demethylation of 1-methyladenine (1-meA) and 3-methylcytosine (3-meC) in both DNA and RNA. AlkB
Thai Q Tran et al.
PLoS biology, 15(11), e2002810-e2002810 (2017-11-07)
Driven by oncogenic signaling, glutamine addiction exhibited by cancer cells often leads to severe glutamine depletion in solid tumors. Despite this nutritional environment that tumor cells often experience, the effect of glutamine deficiency on cellular responses to DNA damage and
Kiyohiko Hotta et al.
Oncology reports, 34(2), 648-654 (2015-06-03)
Prostate cancer antigen-1 (PCA-1)/ALKBH3 has been recently identified in human prostate cancer and its expression is correlated with disease progression and prognosis. However, the precise role and function of PCA-1/ALKBH3 in human malignancies are largely unknown. In the present study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico